LOCUS       NM_171525               3218 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Piwi domain-containing protein (rde-1),
            mRNA.
ACCESSION   NM_171525
VERSION     NM_171525.7
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 3218)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 3218)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3218)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 3218)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003283).
            
            On Feb 2, 2021 this sequence version replaced NM_171525.6.
FEATURES             Location/Qualifiers
     source          1..3218
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="V"
     gene            1..3218
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /db_xref="GeneID:179393"
                     /db_xref="WormBase:WBGene00004323"
     CDS             29..3091
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /standard_name="K08H10.7"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Piwi domain-containing protein"
                     /protein_id="NP_741611.1"
                     /db_xref="EnsemblGenomes-Gn:WBGene00004323"
                     /db_xref="EnsemblGenomes-Tr:K08H10.7"
                     /db_xref="GeneID:179393"
                     /db_xref="GOA:G5EEH0"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR036085"
                     /db_xref="InterPro:IPR036397"
                     /db_xref="UniProtKB/TrEMBL:G5EEH0"
                     /db_xref="WormBase:WBGene00004323"
                     /translation="

MSSNFPELEKGFYRHSLDPEMKWLARPTGKCDGKFYEKKVLLLVNWFKFSSKIYDREYYEYEVKMTKEVLNRKPGKPFPKKTEIPIPDRAKLFWQHLRHEKKQTDFILEDYVFDEKDTVYSVCRLNTVTSKMLVSEKVVKKDSEKKDEKDLEKKILYTMILTYRKKFHLNFSRENPEKDEEANRSYKFLKNVMTQKVRYAPFVNEEIKVQFAKNFVYDNNSILRVPESFHDPNRFEQSLEVAPRIEAWFGIYIGIKELFDGEPVLNFAIVDKLFYNAPKMSLLDYLLLIVDPQSCNDDVRKDLKTKLMAGKMTIRQAARPRIRQLLENLKLKCAEVWDNEMSRLTERHLTFLDLCEENSLVYKVTGKSDRGRNAKKYDTTLFKIYEENKKFIEFPHLPLVKVKSGAKEYAVPMEHLEVHEKPQRYKNRIDLVMQDKFLKRATRKPHDYKENTLKMLKELDFSSEELNFVERFGLCSKLQMIECPGKVLKEPMLVNSVNEQIKMTPVIRGFQEKQLNVVPEKELCCAVFVVNETAGNPCLEENDVVKFYTELIGGCKFRGIRIGANENRGAQSIMYDATKNEYAFYKNCTLNTGIGRFEIAATEAKNMFERLPDKEQKVLMFIIISKRQLNAYGFVKHYCDHTIGVANQHITSETVTKALASLRHEKGSKRIFYQIALKINAKLGGINQELDWSEIAEISPEEKERRKTMPLTMYVGIDVTHPTSYSGIDYSIAAVVASINPGGTIYRNMIVTQEECRPGERAVAHGRERTDILEAKFVKLLREFAENNDNRAPAHIVVYRDGVSDSEMLRVSHDELRSLKSEVKQFMSERDGEDPEPKYTFIVIQKRHNTRLLRRMEKDKPVVNKDLTPAETDVAVAAVKQWEEDMKESKETGIVNPSSGTTVDKLIVSKYKFDFFLASHHGVLGTSRPGHYTVMYDDKGMSQDEVYKMTYGLAFLSARCRKPISLPVPVHYAHLSCEKAKELYRTYKEHYIGDYAQPRTRHEMEHFLQTNVKYPGMSFA"

     misc_feature    866..1285
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1073..1075,1118..1120,1169..1171,1181..1183,
                     1232..1234,1253..1255,1259..1261)
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1427..2974
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1922..1924,1934..1936,1970..1981,1988..1990,
                     2039..2041,2048..2050,2060..2062,2072..2074)
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2180..2182,2186..2188,2429..2431,2948..2950)
                     /gene="rde-1"
                     /locus_tag="CELE_K08H10.7"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

ataatcaacagccacaaagtgatgaaacatgtcctcgaattttcccgaattggaaaaaggattttatcgtcattctctcgatccggagatgaaatggcttgcgaggcccactggtaaatgcgacggcaaattctatgagaagaaagtacttcttttggtaaattggttcaagttctccagcaaaatttacgatcgggaatactacgagtatgaagtgaaaatgacaaaggaagtattgaatagaaaaccaggaaaacctttcccaaaaaagacagaaattccaattcccgatcgtgcaaaactcttctggcaacatcttcggcatgagaagaagcagacagattttattctcgaagactatgtttttgatgaaaaggacactgtttatagtgtttgtcgactgaacactgtcacatcaaaaatgctggtttcggagaaagtagtaaaaaaggattcggagaaaaaagatgaaaaggatttggagaaaaaaatcttatacacaatgatacttacctatcgtaaaaaatttcacctgaactttagtcgagaaaatccggaaaaagacgaagaagcgaatcggagttacaaattcctgaagaatgttatgacccagaaagttcgctacgcgccttttgtgaacgaggagattaaagtacaattcgcgaaaaattttgtgtacgataataattcaattctgcgagttcctgaatcgtttcacgatccaaacagattcgaacaatcattagaagtagcaccaagaatcgaagcatggtttggaatttacattggaatcaaagaattgttcgatggtgaacctgtgctcaattttgcaattgtcgataaactattctacaatgcaccgaaaatgtctcttctggattatcttctcctaattgtcgacccccagtcgtgtaacgatgatgtacgaaaagatcttaaaacaaaactgatggcgggaaaaatgacaatcagacaagccgcgcggccaagaattcgacaattattggaaaatttgaagctgaaatgcgcagaagtttgggataacgaaatgtcgagattgacagaacgacatctgacatttctagatttgtgcgaggaaaactctcttgtttataaagtcactggtaaatcggacagaggaagaaatgcaaaaaagtacgatactacattgttcaaaatctatgaggaaaacaaaaagttcattgagtttccccacctaccactagtcaaagttaaaagtggagcaaaagaatacgctgtaccaatggaacatcttgaagttcatgagaagccacaaagatacaagaatcgaattgatctggtgatgcaagacaagtttctaaagcgagctacacgaaaacctcacgactacaaagaaaataccctaaaaatgctgaaagaattggatttctcttctgaagagctaaattttgttgaaagatttggattatgctccaaacttcagatgatcgaatgtccaggaaaggttttgaaagagccaatgcttgtgaatagtgtaaatgaacaaattaaaatgacaccagtgattcgtggatttcaagaaaaacaattgaatgtggttcccgaaaaagaactttgctgtgctgtttttgtagtcaacgaaacagcgggaaatccatgcttagaagagaacgacgttgttaagttctacaccgaactaattggtggttgcaagttccgtggaatacgaattggtgccaatgaaaacagaggagcgcaatctattatgtacgacgcgacgaaaaatgaatatgccttctacaaaaattgtacactaaataccggaatcggtagatttgaaatagccgcaacagaagcgaagaatatgtttgaacgtcttcccgataaagaacaaaaagtcttaatgttcattatcatttccaaacgacaactgaatgcttacggttttgtgaaacattattgcgatcacaccatcggtgtagctaatcagcatattacttctgaaacagtcacaaaagctttggcatcactaaggcacgagaaaggatcaaaacgaattttctatcaaattgcattgaaaatcaacgcgaaattaggaggtattaaccaggagcttgactggtcagaaattgcagaaatatcaccagaagaaaaagaaagacggaaaacaatgccattaactatgtatgttggaattgatgtaactcatccaacctcctacagtggaattgattattctatagcggctgtagtagcgagtatcaatccaggtggaactatctatcgaaatatgattgtgactcaagaagaatgtcgtcccggtgagcgtgcagtggctcatggacgggaaagaacagatattttggaagcaaagttcgtgaaattgctcagagaattcgcagaaaacaacgacaatcgagcaccagcgcatattgtagtctatcgagacggagttagcgattcggagatgctacgtgttagtcatgatgagcttcgatctttaaaaagcgaagtaaaacaattcatgtcggaacgggatggagaagatccagagccgaagtacacgttcattgtgattcagaaaagacacaatacacgattgcttcgaagaatggaaaaagataagccagtggtcaataaagatcttactcctgctgaaacagatgtcgctgttgctgctgttaaacaatgggaggaggatatgaaagaaagcaaagaaactggaattgtgaacccatcatccggaacaactgtggataaacttatcgtttcgaaatacaaattcgattttttcttggcatctcatcatggtgtccttggtacatctcgtccaggacattacactgttatgtatgacgataaaggaatgagccaagatgaagtctataaaatgacctacggacttgcttttctctctgctagatgtcgaaaacccatctcgttgcctgttccggttcattatgctcatttatcatgtgaaaaagcgaaagagctttatcgaacttacaaggaacattacatcggtgactatgcacagccacggactcgacacgaaatggaacattttctccaaactaacgtgaagtaccctggaatgtcgttcgcataacattttgcaaaagtgtcgcccgtttcaatcaaatttttcaattgtagatattgtacttacttttttttaaagcccggtttcaaaaattcattccatgactaacgttttcataaattacttgaaattt

//