2024-05-03 04:46:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001047474 2604 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Piwi domain-containing protein (csr-1), partial mRNA. ACCESSION NM_001047474 VERSION NM_001047474.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 2604) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 2604) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2604) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 2604) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003282). On Apr 15, 2020 this sequence version replaced NM_001047474.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2604 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="IV" gene <1..>2604 /gene="csr-1" /locus_tag="CELE_F20D12.1" /db_xref="GeneID:177591" /db_xref="WormBase:WBGene00017641" CDS 1..2604 /gene="csr-1" /locus_tag="CELE_F20D12.1" /standard_name="F20D12.1b" /note="Confirmed by transcript evidence" /codon_start=1 /product="Piwi domain-containing protein" /protein_id="NP_001040939.1" /db_xref="EnsemblGenomes-Gn:WBGene00017641" /db_xref="EnsemblGenomes-Tr:F20D12.1b" /db_xref="GeneID:177591" /db_xref="GOA:Q27GU1" /db_xref="InterPro:IPR003100" /db_xref="InterPro:IPR003165" /db_xref="InterPro:IPR012337" /db_xref="InterPro:IPR036085" /db_xref="InterPro:IPR036397" /db_xref="UniProtKB/TrEMBL:Q27GU1" /db_xref="WormBase:WBGene00017641" /translation="
MNQKQNPRLALNIFGLELSERTIFRHVVQMKLIDRQHNKEYILTTMSARGRGNRATKQKDNFILLDILLKQWAAKKGQQNLPAFAYDGAQSLFTLEGISLMVDIKKEDALEIPELSNFLKDSISFLSGDLEISCEPDLEKPSFVQTELNEWSDPRFYAYLDIVTSQSAIRSERYLSQSKGLYVHTQSLEELRVKWAVAAKGIHKGCRIVGANGPLPILELDPQSTQYYASIPLSQMLQYAFPRDFPPNRIVNPNMKLQRAVKLLLKDLKCNPYYDDKQIWATNTITVSDVDYNAPKDPEFRQKYPNLKFPMLPAVQCGTGPHKRLMPLEYLKVLPYQSIDRRVLEEFELTPRANAPNERWSTLQKHYDQFGFNDQVMKDFGVQICNDPFNNVSEIDGERVLAPSVAYADPVHVDDEKRDWKAQDKKFVTPATIDHLMFVLVAGYTRTWDADCDATKFVAKAFMQRCKDKGMHIGSYSMDQHNGERGSENFLTSVFKNLVTHPNYRDSSFTPFVLFISDDVPNIHECLKFEERMSDIPTQHVLLKNVKKMRDNIEKKSQGGRRAYDLTLDNIVMKANIKCGGLNYTADIPRDLACWNEVSTFVIGMDVAHPDRNAAREGNPSTVGLSCNSAENPYSFIGDFLYTDPRREAIQDEILRKFTDQSVRNFAEIRGFPKKVIIFRDGVSFGEETAALKEVEIIEQTIKTAAKSMGHSDYAPKVLAIVVKKRHHTRFYAKGGHHGNMPINPLPDTSVGGDIAEYGKRQIFIQAFRPVQGTAKVPSFLVIRDDEEVSDEHVAKMVCAVCSLHQLVNSPTSIPTPVYVAHELAKRGTGLYKAYRFKNGELFDDWETLTTQLSYSTLDRLSKVRVV"
misc_feature 592..1002 /gene="csr-1" /locus_tag="CELE_F20D12.1" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(802..804,847..849,865..867,898..900,949..951, 970..972,976..978) /gene="csr-1" /locus_tag="CELE_F20D12.1" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1174..2490 /gene="csr-1" /locus_tag="CELE_F20D12.1" /note="PIWI domain. Domain found in proteins involved in RNA silencing. RNA silencing refers to a group of related gene-silencing mechanisms mediated by short RNA molecules, including siRNAs, miRNAs, and heterochromatin-related guide RNAs. The central component...; Region: Piwi-like; cd02826" /db_xref="CDD:239208" misc_feature order(1570..1572,1582..1584,1615..1626,1633..1635, 1699..1701,1708..1710,1720..1722,1732..1734) /gene="csr-1" /locus_tag="CELE_F20D12.1" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:239208" misc_feature order(1816..1818,1822..1824,2041..2043,2464..2466) /gene="csr-1" /locus_tag="CELE_F20D12.1" /note="active site" /db_xref="CDD:239208" ORIGIN
atgaatcagaagcaaaatccaagacttgccctgaacatcttcgggcttgagctctctgagcgaacgattttccggcatgttgtgcaaatgaagctcatcgatcgtcagcacaataaggagtatattcttacaacaatgagtgccagaggacgtggaaaccgtgcaacaaagcaaaaagataactttattcttcttgacatcctactcaaacagtgggccgcgaagaagggtcagcagaatcttcctgcattcgcgtacgacggtgcacagtctttattcactttggagggaatcagcttgatggtcgatatcaagaaagaagatgctctcgaaatcccggaactttccaattttctgaaggattccatctcgttcctcagcggcgatttggagatctcttgtgaaccggatctcgagaaaccgtcattcgttcagacggagcttaacgaatggagtgatccaagattctacgcttatttggatattgtgacatcacagagtgccattagaagcgaaagatatttgtcgcagtcgaaaggtctctatgtccacactcaaagcttggaggagcttcgcgtgaaatgggctgttgcagcaaaaggaatccacaaaggatgccgaatcgtcggagcaaacggacctcttccaattctagaactcgatcctcaatcgactcagtactatgcttcaatcccactcagtcagatgttgcagtacgcatttcctcgtgattttccgccaaaccgtatcgttaatccaaatatgaaactgcaaagagccgtgaaactattgttgaaggatttaaaatgcaacccatattacgatgacaaacagatttgggctacgaacactatcacagtgtcggatgttgactacaacgcgccgaaagatccagaattcagacaaaagtatccaaatctgaaattcccaatgcttcctgcagttcaatgcggcactggaccacacaagcgcctcatgccgctcgaatatttgaaggttcttccttatcaatccattgaccgccgtgtactcgaagagtttgagcttacaccacgagcgaatgccccgaacgaacgctggtcaactcttcaaaaacactacgatcaatttggtttcaacgatcaagtcatgaaagattttggtgtccaaatctgcaatgatcctttcaacaacgtcagtgagatcgacggtgaaagagtcctcgcgcctagtgttgcatatgcagacccggtacacgtggatgatgagaagcgtgactggaaagcacaagacaaaaagtttgttacacctgctacgattgaccatttgatgttcgttctagtagcaggttatactcgaacttgggatgctgattgcgatgcaaccaaatttgtcgcgaaagcattcatgcagcgttgcaaggacaaaggaatgcacattggcagttatagcatggatcagcacaatggcgaacgaggcagcgaaaatttccttacttcggtcttcaaaaacttggtgactcatccaaactaccgggattcgtctttcactccgttcgtcttgtttatttccgatgacgttcctaacattcatgagtgcctcaaattcgaagagcgtatgagtgacattccaacgcagcacgtacttctcaaaaatgtcaaaaagatgcgtgacaacatcgaaaagaagtctcaaggtggaagaagagcatatgatttgactcttgacaatattgtgatgaaagccaacattaaatgcggtggacttaactacacagcagatattccaagagatcttgcgtgctggaatgaagtttctaccttcgtaattggaatggacgttgctcatcctgaccgaaacgctgcgagagaaggaaatccatccaccgtcggactgtcctgcaattctgctgaaaacccatactcgttcattggagacttcttatacaccgatcctagaagagaggcgatccaggatgaaattttgcgaaaattcactgaccaaagcgttcgaaactttgccgaaattcgaggtttcccaaagaaagtaatcatcttccgtgatggtgtttcattcggtgaagagactgcggctctgaaggaggtggaaatcattgagcaaaccattaagacagccgctaagtccatgggccattctgattatgctccaaaagtattagccattgttgttaaaaaacgtcaccacactcgattctacgccaagggaggacatcacgggaacatgccgatcaatccgcttcccgatacatctgttggtggtgatattgccgaatatggaaaaagacaaatcttcatccaagctttccggccagtgcaaggtactgcaaaggttccatcattcttggttattcgagatgatgaggaagtttcggacgaacatgttgccaaaatggtttgcgccgtatgcagtcttcatcagcttgttaacagtccaacatccatcccaactccagtttacgttgctcatgagctcgccaagagaggaaccgggctttacaaagcttataggttcaagaatggcgaactctttgatgattgggaaacgctcaccactcaactctcctatagcactctcgatcgactttcaaaagttcgagttgtttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]