2024-05-04 23:46:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_123317 2259 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana Zinc finger (C3HC4-type RING finger) family protein (VIM3), mRNA. ACCESSION NM_123317 VERSION NM_123317.4 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 2259) AUTHORS Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E., Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K., Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S., Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M., Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R., Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J., Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J., Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L., Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B., Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E., Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A., Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M., See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L., Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R., Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R., Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N., Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B., Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H., Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W., Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M., Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K., Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C., Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P. CONSRTM Kazusa DNA Research Institute; Cold Spring Harbor and Washington University in St Louis Sequencing Consortium; European Union Arabidopsis Genome Sequencing Consortium TITLE Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 823-826 (2000) PUBMED 11130714 REFERENCE 2 (bases 1 to 2259) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2259) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 2259) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003076). On Sep 12, 2016 this sequence version replaced NM_123317.3. FEATURES Location/Qualifiers source 1..2259 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="5" /ecotype="Columbia" gene 1..2259 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="Encodes the VIM3/ORTH1 protein that is similar to VIM1. This protein has an N-terminal PHD domain and two RING domains surrounding an SRA domain. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. This protein functions as an E3 ubiquitin ligase in vitro with members of the UBC8 family E2s. Either of the two RING domains present in the protein can promote ubiquitylation in vitro, but, not the PHD domain. Over-expression of ORTH1/VIM3 leads to decreased levels of FWA methylation, increased levels of FWA transcripts, and delayed flowering. Cen180 repeats are also hypomethylated in plants overexpressing this protein." /db_xref="Araport:AT5G39550" /db_xref="GeneID:833951" /db_xref="TAIR:AT5G39550" CDS 176..2029 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /inference="Similar to RNA sequence, EST:INSD:BP615354.1,INSD:BP857153.1,INSD:ES103244.1, INSD:EL993422.1,INSD:BP806510.1,INSD:EG516339.1" /inference="similar to RNA sequence, mRNA:INSD:AK221256.1,INSD:AK176778.1,INSD:BT010573.1" /note="VARIANT IN METHYLATION 3 (VIM3); CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SRA-YDG (InterPro:IPR003105), Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: Zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G66040.1); Has 6556 Blast hits to 5308 proteins in 497 species: Archae - 0; Bacteria - 14; Metazoa - 4783; Fungi - 431; Plants - 899; Viruses - 19; Other Eukaryotes - 410 (source: NCBI BLink)." /codon_start=1 /product="Zinc finger (C3HC4-type RING finger) family protein" /protein_id="NP_198771.1" /db_xref="GeneID:833951" /db_xref="TAIR:AT5G39550" /db_xref="Araport:AT5G39550" /translation="
MAIETQLPCDGDGVCMRCQVNPPSEETLTCGTCVTPWHVPCLLPESLASSTGEWECPDCSGVVVPSAAPGTGNARPESSGSVLVAAIRAIQADETLTEAEKAKKRQKLMSGGGDDGVDEEEKKKLEIFCSICIQLPERPITTPCGHNFCLKCFEKWAVGQGKLTCMICRSKIPRHVAKNPRINLALVSAIRLANVTKCSVEATAAKVHHIIRNQDRPEKAFTTERAVKTGKANAASGKFFVTIPRDHFGPIPAENDVTRKQGVLVGESWEDRQECRQWGAHFPHIAGIAGQSAVGAQSVALSGGYDDDEDHGEWFLYTGSGGRDLSGNKRINKKQSSDQAFKNMNESLRLSCKMGYPVRVVRSWKEKRSAYAPAEGVRYDGVYRIEKCWSNVGVQGSFKVCRYLFVRCDNEPAPWTSDEHGDRPRPLPNVPELETAADLFVRKESPSWDFDEAEGRWKWMKSPPVSRMALDPEERKKNKRAKNTMKARLLKEFSCQICREVLSLPVTTPCAHNFCKACLEAKFAGITQLRERSNGGRKLRAKKNIMTCPCCTTDLSEFLQNPQVNREMMEIIENFKKSEEEADASISEEEEEESEPPTKKIKMDNNSVGGSGTSLSA"
misc_feature 215..352 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="PHD zinc finger; Region: PHD; smart00249" /db_xref="CDD:214584" misc_feature order(254..265,275..277,335..337) /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="histone H3 binding site [polypeptide binding]; other site" /db_xref="CDD:276966" misc_feature 467..>643 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="E3 ubiquitin-protein ligase RMA2; Provisional; Region: PLN03208" /db_xref="CDD:178747" misc_feature 560..682 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="The superfamily of RING finger (Really Interesting New Gene) domain and U-box domain; Region: RING_Ubox; cl17238" /db_xref="CDD:418438" misc_feature order(560..562,569..571,605..607,611..613,620..622, 629..631,668..670,677..679) /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="cross-brace motif; other site" /db_xref="CDD:319361" misc_feature 914..1402 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="SAD/SRA domain; Region: SAD_SRA; pfam02182" /db_xref="CDD:396656" misc_feature <1517..1732 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="RING-finger-containing E3 ubiquitin ligase [Posttranslational modification, protein turnover, chaperones]; Region: PEX10; COG5574" /db_xref="CDD:227861" misc_feature 1652..1840 /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="The superfamily of RING finger (Really Interesting New Gene) domain and U-box domain; Region: RING_Ubox; cl17238" /db_xref="CDD:418438" misc_feature order(1658..1660,1667..1669,1703..1705,1709..1711, 1718..1720,1727..1729,1817..1819,1826..1828) /gene="VIM3" /locus_tag="AT5G39550" /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT IN METHYLATION 3" /note="cross-brace motif; other site" /db_xref="CDD:319361" ORIGIN
atttttttcttttttaggtttttacaaatcattttgaaattcactcttcgccttccccaaaatttcaaaacccgcctcttcacttttcgccttcctctacttatttagcctaaatctctcataaatctggaaaacaacattttctctctaaatctctctctcactcgtttcaacaatggcgattgaaactcagcttccttgcgacggtgacggtgtgtgtatgcggtgtcaggtgaatcctccgtcagaagagactctcacttgtggcacgtgcgtcactccatggcacgtgccgtgtctcctccccgaatcactcgcttcttccactggagagtgggagtgtcccgattgctccggcgttgtcgttccctccgccgctccgggtaccggaaacgctcgacctgaatcttccggttcagttctcgttgctgcgatccgtgcgattcaggctgatgagactttaaccgaagctgagaaagccaaaaaaaggcagaaactgatgagtgggggtggtgacgatggtgtcgatgaagaagagaagaagaagttagaaatcttttgttctatttgcattcaattgccagaaagacctatcacgacaccgtgtgggcacaatttctgtttgaaatgtttcgagaaatgggcagtaggtcaagggaagctaacttgtatgatatgccgaagcaaaattccgagacatgtggcaaaaaatcctcgcatcaacttagctctagtttctgctattcgtttagcaaatgttaccaaatgttctgttgaggcaactgcagccaaggttcatcatattatccgcaaccaagaccgtcctgagaaagcatttactaccgagcgggcagtaaaaactgggaaagctaatgctgctagcggtaagttttttgtgacaatacctcgtgatcattttggtcccataccagctgagaatgatgtcactagaaagcaaggtgttttggttggagaatcttgggaggacaggcaagagtgtaggcagtggggagctcatttcccgcatattgctggcattgccgggcaatcagcggttggagctcagtctgtggccctctctggaggttatgacgatgatgaggatcatggtgaatggtttctctacacaggaagtggtggaagggatctcagtggaaacaaaagaattaacaagaaacagtcgtctgaccaggcgtttaaaaacatgaatgaatctctaagacttagttgcaaaatgggctatcctgtccgagttgtcaggtcttggaaggagaagcgttctgcatatgcccctgctgaaggtgtgagatatgatggggtctatcgaattgagaagtgctggagtaatgttggagtacagggttcttttaaggtctgtcgttacctgtttgttagatgtgacaatgagccagctccatggaccagtgatgagcatggcgatcgtccaagaccgttgcctaatgttccggagcttgagactgctgctgacctgtttgtgagaaaggagagtccatcatgggatttcgatgaagctgagggtcgttggaaatggatgaagtctcctcctgttagcagaatggctttggatcctgaggagaggaagaagaataagagagcaaaaaatactatgaaggccagacttctgaaagaatttagttgccaaatctgtcgggaagtgctgagtcttccagtgacgacgccttgtgcacacaacttctgcaaagcatgcttagaagcgaagtttgctgggataactcaactgagagagagaagcaatggcggacgtaaactacgtgcaaagaagaacatcatgacctgcccttgctgcacgacggatctctccgagtttctccaaaacccgcaggtgaacagagagatgatggagataatagagaattttaagaagagtgaggaagaggctgatgcatccatttctgaagaagaagaagaagaatccgaacctccaactaagaagattaagatggataacaactctgttggtggtagtggtacaagtctctcagcttaaggagctctttagtttttcgaaacaaacttcctttctttttttggtaatattccgcaaacgtctgtgaagtttgcattgcgacttatcatttttattttaaaacttatcagaaattgttcgaatcttttttttccgttacatataaattcaacattagtatattactttaaattttcgtggtcagtgagttaccacaacaaattctctataaactaatatatcgataaatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]