2024-04-25 16:38:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_781255 417 bp RNA linear ROD 23-APR-2020 DEFINITION PREDICTED: Fukomys damarensis uncharacterized LOC104865732 (LOC104865732), ncRNA. ACCESSION XR_781255 VERSION XR_781255.1 DBLINK BioProject: PRJNA625221 KEYWORDS RefSeq. SOURCE Fukomys damarensis (Damara mole-rat) ORGANISM Fukomys damarensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Bathyergidae; Fukomys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_022900944.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Fukomys damarensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..417 /organism="Fukomys damarensis" /mol_type="transcribed RNA" /isolate="Sample0158" /db_xref="taxon:885580" /chromosome="Unknown" /sex="female" /tissue_type="blood from cranial vena cava" /country="USA: Houston Zoo, Houston, TX" /collection_date="05-Sep-2016" /collected_by="Joseph P. Flanagan, Kelcie Pletch, Christine Molter, Maryanne Tocidlowski, Lauren Howard, Judilee Marrow, Andrea Lee, Jess Jimerson, Katie Plaeger, Erin Neer" gene 1..417 /gene="LOC104865732" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:104865732" ncRNA 1..417 /ncRNA_class="lncRNA" /gene="LOC104865732" /product="uncharacterized LOC104865732" /db_xref="GeneID:104865732" ORIGIN
tgtagaggagactccagagaactctcctgccttctgccatctgaagacacagtaggaaaaaggacatctgtaaaccagcaaaccattcaaagagaatggatttcagtttgactcaaggagttgcctggctgtgaaatggactacagtaatgatagtcacagaagatggttcaagaagagattggacaaaccaactgaaggagacatcgtgaagaagacttgaataccaggtaggctctatagtcagcacagaatgttcagcacggtccaagaaaatcactgtatactggacctttaggatggtgaaccgaggagctgcgaggctggggtgcttcctggaagaatgagagctaagctcaaagccaggcttctgctcctcgatgctacatgttcaaataaaaaagtatacccctggcct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]