ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-15 09:27:11, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_781255 417 bp RNA linear ROD 23-APR-2020
DEFINITION PREDICTED: Fukomys damarensis uncharacterized LOC104865732
(LOC104865732), ncRNA.
ACCESSION XR_781255
VERSION XR_781255.1
DBLINK BioProject: PRJNA625221
KEYWORDS RefSeq.
SOURCE Fukomys damarensis (Damara mole-rat)
ORGANISM Fukomys damarensis
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
Hystricomorpha; Bathyergidae; Fukomys.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_022900944.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Fukomys damarensis Annotation
Release 102
Annotation Version :: 102
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.4
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..417
/organism="Fukomys damarensis"
/mol_type="transcribed RNA"
/isolate="Sample0158"
/db_xref="taxon:885580"
/chromosome="Unknown"
/sex="female"
/tissue_type="blood from cranial vena cava"
/geo_loc_name="USA: Houston Zoo, Houston, TX"
/collection_date="05-Sep-2016"
/collected_by="Joseph P. Flanagan, Kelcie Pletch,
Christine Molter, Maryanne Tocidlowski, Lauren Howard,
Judilee Marrow, Andrea Lee, Jess Jimerson, Katie Plaeger,
Erin Neer"
gene 1..417
/gene="LOC104865732"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:104865732"
ncRNA 1..417
/ncRNA_class="lncRNA"
/gene="LOC104865732"
/product="uncharacterized LOC104865732"
/db_xref="GeneID:104865732"
ORIGIN
tgtagaggagactccagagaactctcctgccttctgccatctgaagacacagtaggaaaaaggacatctgtaaaccagcaaaccattcaaagagaatggatttcagtttgactcaaggagttgcctggctgtgaaatggactacagtaatgatagtcacagaagatggttcaagaagagattggacaaaccaactgaaggagacatcgtgaagaagacttgaataccaggtaggctctatagtcagcacagaatgttcagcacggtccaagaaaatcactgtatactggacctttaggatggtgaaccgaggagctgcgaggctggggtgcttcctggaagaatgagagctaagctcaaagccaggcttctgctcctcgatgctacatgttcaaataaaaaagtatacccctggcct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]