GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-05-31 12:42:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XR_013517489             860 bp    RNA     linear   PLN 24-DEC-2025
DEFINITION  PREDICTED: Carex rostrata testis- and ovary-specific PAZ domain
            protein (LOC144571339), transcript variant X2, misc_RNA.
ACCESSION   XR_013517489
VERSION     XR_013517489.1
DBLINK      BioProject: PRJNA1391555
KEYWORDS    RefSeq.
SOURCE      Carex rostrata
  ORGANISM  Carex rostrata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Cyperaceae;
            Cyperoideae; Cariceae; Carex; Carex subgen. Carex.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135936) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_964058835.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..860
                     /organism="Carex rostrata"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:241230"
                     /chromosome="19"
                     /geo_loc_name="United Kingdom:Aberlady"
                     /collection_date="2021-06-14"
     gene            1..860
                     /gene="LOC144571339"
                     /note="testis- and ovary-specific PAZ domain protein;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 22 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:144571339"
     misc_RNA        1..860
                     /gene="LOC144571339"
                     /product="testis- and ovary-specific PAZ domain protein,
                     transcript variant X2"
                     /db_xref="GeneID:144571339"
ORIGIN      
ataatcagacgtaaagatgaagaaacgaccgttacttgtgcgttacacctatgccaaattgcccatattgaatacttcctccaatcggaagaatcgaagctggttcttctccatacttgaggcaactcagatcctctctctctctctctcttttgtttctctttttctctaatgcataataatcccattctacaattttatgtaatacagtatttctctgccattatttttgtttgtcaattaagtattgggtgcggaacaattgaacatgcggcttcgacacaaagaaggattgaatgaatctttggaggcagagcaccattctttggcgagtttagtagtgataaggagagcacatacaacaaaagaagccatagaggatttgctctgggttgtttttgccatttttatcgtatatttgggtgattgccaaactaatctggtgtctatcttgctctgggacccgaggattgatcgctttgctgcttgggctatcgggcgtttcacttaatgtcggctttatcctttattcgacatttttgtccagctatagactgaaatttcataaagaacatgagctatctaatgtagaagcacctacattattagacgagaagcctgaattctctctaaagattacaaggtttcttctcctcatagggatttctacattttgcatgttattgtatgcattatggccaatttggagatttttgagcattcttcttttgctttccttgctaatgtcttccacagctatgtcaccatacttggtaggagcggtaaccaaatttctgattcttgctttctgaagagaaatgcatgtattaccataattagatcaccaaacctctcttgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]