ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-04-24 21:03:36, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_012822809 2282 bp RNA linear INV 23-JUL-2025 DEFINITION PREDICTED: Dermacentor variabilis visceral mesodermal armadillo-repeats (vimar), transcript variant X3, misc_RNA. ACCESSION XR_012822809 VERSION XR_012822809.1 DBLINK BioProject: PRJNA1294369 KEYWORDS RefSeq. SOURCE Dermacentor variabilis (American dog tick) ORGANISM Dermacentor variabilis Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida; Acari; Parasitiformes; Ixodida; Ixodoidea; Ixodidae; Rhipicephalinae; Dermacentor. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_134568) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_050947875.1-RS_2025_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/22/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2282 /organism="Dermacentor variabilis" /mol_type="transcribed RNA" /isolate="Ectoservices" /db_xref="taxon:34621" /chromosome="1" /sex="male" /tissue_type="Whole body" /geo_loc_name="USA: Stillwater, Oklahoma" /collection_date="2022-03" gene 1..2282 /gene="vimar" /note="visceral mesodermal armadillo-repeats; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:142557678" misc_RNA 1..2282 /gene="vimar" /product="visceral mesodermal armadillo-repeats, transcript variant X3" /db_xref="GeneID:142557678" ORIGIN
ttttattttgttgggggcgtgctgcgctgctgcagcggtgaagagtcgcgtaaatgatgcggatgtgcccagttatttcccacaacaacgtgcagtaaagcacactcttgatcagctgcgcgcgaaatggaaagcatcacagaaatactcgatggactgaagctctgcgttggcgacgaacaaaaagtggacgatgccgatttatttcttcgcctgaagagtctcctggcactcctcgcagctgatgaacaacattccaagtccgaagcgaaccggcagcaggtgtgtgagcgtctcgtgaagagtgcgtttgtcagttccacaaaagatattctcaagggttcctcagccgtcactgaagaaaccttggctctccttgttcaagtgatagccgaagcggccaaatatgagcctctgaggaaacagttcacagaagcagctgttgtggatcctctcctgggacttatatctcataagaactatgcagtggtgctccaggcttgccgtgctcttggaaacatctgttatgataacgacgatggaagggaccttgtccgggctaagcaaggtgtcgagcagctgttgcaacttctgcagaatgttcttgaagtcgactcagcaccaagagatctgcatactgttgtttcagggtgcctcctaaatttgaccgatatgcaagaaatacaagaggacgcccttcgtttgggtgtgattgatattctgctcaagtacctccaaaagtattcggatgttgaagatgtcgtcatgcactgtgtcttggtgctcaacggcattgctgattcagacgatggtcgtaagcgacttaccgaaaaacacacactgtctcttctgcttagtaatcttgacagagttttctcggaagaagtgactgaagttttgctcgagttgtttggaaatcttgctgaaagtgatgaggtgaaagaggaccttgtggaactgggcttttgcgagaagctcattgaagtgctgaagcgatttcaacctgggtctggcactcctttgtcagaagagaagcagagcgtgataaagactatctgtgaccttacagtcctagtcctaactggagatgctagcatgcggcatgtctaccaaaatggtagtgggcccatctacaaagccaccatggcatggctccagacggacgatgacaaccttcgtgtggctggagccctttcagcaggcaactttgcccgcaaagatgatcactgcattcagatggtcagagatggtgttgccaaacgtctgctggacctcctcacggagcacactggcacagacggagacatcagactgcagcatgccttactggcagcattgcggaaccttgccatcccattggaaaacaagcctctgctagcagaacttggcgctgttgacaagttgctttcaatgctggctgtggagacattccctgtcgtcttcaaacttctgggcacattacgtatgctagttgataagcaagaggttgtggctacaaagttgggcctaaatgagcaactggtgaagcaccttgtgacgtggtgtagcactgaggaccacccaggtgtcaaaggtgaatcagtgcggctattggcctggatagcgaaaaacagtgcatcacctgaagccaaagcagtactatgccgtctgggtgcattgccgcactgggtgtccatgctttcctccgagcatagtctcatgcaggctgaggggctgctggctctcacactttccctcagtccaccgccatctggtactgctctggaagatttgaaaaaggctgatgttcttcctctgctgcgatcattacttgagtcaccagaaatatcacctgaagctctgcagaatgcagttgctttcactactgcactagccagccttgaggtctgcgctttgaacttcagaaggcacgaatacagagtgaaagaactcggttatgatgtggcctccgaaatccatgtacggaatgctgtctttcgtcggagcgatgtgacgccggaaacattgtggtgaacatttcataaaagaaggctacttcgacaacataatctggaaacaaacaagaaaaattactttctgaaatcactggcgaggtcgcaaaaaaattcccctacacagaacacatgctatcccgaaacatggaaagttgatagatgccgcacgacctacgcagccaggtatggttccaatgcgccagcgctgtacgcacatcacatcagccggccagctccacatctgcctgttcatctcaagtaggatgtcaactgccggtgacctctctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]