GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-24 00:19:37, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XR_009623496             908 bp    RNA     linear   INV 03-NOV-2023
DEFINITION  PREDICTED: Ruditapes philippinarum uncharacterized LOC132713846
            (LOC132713846), ncRNA.
ACCESSION   XR_009623496
VERSION     XR_009623496.1
DBLINK      BioProject: PRJNA1033681
KEYWORDS    RefSeq.
SOURCE      Ruditapes philippinarum (Manila clam)
  ORGANISM  Ruditapes philippinarum
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Heteroconchia; Euheterodonta; Imparidentia;
            Neoheterodontei; Venerida; Veneroidea; Veneridae; Ruditapes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026860903) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_026571515.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/30/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..908
                     /organism="Ruditapes philippinarum"
                     /mol_type="transcribed RNA"
                     /isolate="M1"
                     /isolation_source="lagoon"
                     /db_xref="taxon:129788"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="mantle"
                     /dev_stage="adult clam"
                     /country="USA: Puget Sound region, Pacific Northwest"
                     /collection_date="2014-10"
     gene            1..908
                     /gene="LOC132713846"
                     /note="uncharacterized LOC132713846; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:132713846"
     ncRNA           1..908
                     /ncRNA_class="lncRNA"
                     /gene="LOC132713846"
                     /product="uncharacterized LOC132713846"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:132713846"
ORIGIN      
caaaatcaataggggtcttctacccaatatggacaatcatcctatgaagtttgaatattgtgggctaaatggaactaaagttatgctcaagaaactgttttcaaattctaagtaatagtgaccttgacctttgaccttgtgaccccaaaatcaataggggtattctacccaatatggacaatcatcctatgaagtttgaacactgtgggccaaatagaacttaagttatgctccggaaactgttttcagttctaaggtcataatgaccttgacctttgacctgtgaccccaaaatctaaaggggtcttctaccaaatatggacaatcatcctatgaagtttgaacactgtaggacaaatggaacttaagttatgctccagaaactgttttcagttttaaggtcatagtgaccttgacctttgaccttgtgaccccaaaatcaataggggtcttctaccaaatatggacaatcatcctatgaagtttgaacactgtgggccaaaatgaacttaagttatgctccggaaactgttttcagttttaaggtcatagtgaccttgacctttgaccttatgacccaaaagtcaataggggtcttcaacccaatatggacaatcatcctatgaagtttgaatattgtgggccaaatggaacttaagttatgctccagaaaccaaattgctaacgttttcagttttaaggtcatagtgaccttgacctttgaccttatggccccaaaatcaataggggtcttctacccaatatggacaatcatcctatgaagtttgaatattgtgggccaaatagaacttaagttatgctccggaaaccaaattgctaacggacggacggacggacgccagggggtataacataatatgtccgaaattctttcgggcatataaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]