2024-05-03 01:37:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_009622629 112 bp RNA linear VRT 03-NOV-2023 DEFINITION PREDICTED: Pantherophis guttatus uncharacterized LOC132711909 (LOC132711909), ncRNA. ACCESSION XR_009622629 VERSION XR_009622629.1 DBLINK BioProject: PRJNA1031231 KEYWORDS RefSeq. SOURCE Pantherophis guttatus ORGANISM Pantherophis guttatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Toxicofera; Serpentes; Colubroidea; Colubridae; Colubrinae; Pantherophis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026844037) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_029531705.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/30/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..112 /organism="Pantherophis guttatus" /mol_type="transcribed RNA" /isolate="1" /db_xref="taxon:94885" /chromosome="Unknown" /sex="male" /tissue_type="blood" gene 1..112 /gene="LOC132711909" /note="uncharacterized LOC132711909; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:132711909" ncRNA 1..112 /ncRNA_class="lncRNA" /gene="LOC132711909" /product="uncharacterized LOC132711909" /db_xref="GeneID:132711909" ORIGIN
caactctaatggctctccagtacacatctggaactgctggatggcctcgtggtgagacctcttatacccagggggaggagtcagaggcaagaagagattgcaccaatgaggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]