GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-29 07:49:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_009622629             112 bp    RNA     linear   VRT 03-NOV-2023
DEFINITION  PREDICTED: Pantherophis guttatus uncharacterized LOC132711909
            (LOC132711909), ncRNA.
ACCESSION   XR_009622629
VERSION     XR_009622629.1
DBLINK      BioProject: PRJNA1031231
KEYWORDS    RefSeq.
SOURCE      Pantherophis guttatus
  ORGANISM  Pantherophis guttatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Colubroidea; Colubridae; Colubrinae;
            Pantherophis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026844037) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_029531705.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/30/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..112
                     /organism="Pantherophis guttatus"
                     /mol_type="transcribed RNA"
                     /isolate="1"
                     /db_xref="taxon:94885"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
     gene            1..112
                     /gene="LOC132711909"
                     /note="uncharacterized LOC132711909; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:132711909"
     ncRNA           1..112
                     /ncRNA_class="lncRNA"
                     /gene="LOC132711909"
                     /product="uncharacterized LOC132711909"
                     /db_xref="GeneID:132711909"
ORIGIN      
caactctaatggctctccagtacacatctggaactgctggatggcctcgtggtgagacctcttatacccagggggaggagtcagaggcaagaagagattgcaccaatgaggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]