2024-09-08 09:32:06, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS XR_009214237 343 bp RNA linear PRI 26-JUL-2023 DEFINITION PREDICTED: Hylobates moloch uncharacterized LOC131383852 (LOC131383852), ncRNA. ACCESSION XR_009214237 VERSION XR_009214237.1 DBLINK BioProject: PRJNA600985 KEYWORDS RefSeq. SOURCE Hylobates moloch (silvery gibbon) ORGANISM Hylobates moloch Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hylobatidae; Hylobates. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026652281) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_009828535.3-RS_2023_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/21/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..343 /organism="Hylobates moloch" /mol_type="transcribed RNA" /isolate="HMO894" /isolation_source="EBV transformed lymphoblastoid cell line" /db_xref="taxon:81572" /chromosome="Unknown" /sex="male" /note="Lionel" gene 1..343 /gene="LOC131383852" /note="uncharacterized LOC131383852; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:131383852" ncRNA 1..343 /ncRNA_class="lncRNA" /gene="LOC131383852" /product="uncharacterized LOC131383852" /db_xref="GeneID:131383852" ORIGIN
agcagagggagacatctgaccatggacacagtattgctacttgccagtattctaatttcagatcctgggacctgagattgaaccggcagctgatcaattctgtggaatttagagttcttgttctcggcactgaaccagaattttctttggcaaaagagggaaagcatacaattatggtcagaaacataataataaatccactgtaacaaccttctttccaccacatatctttgctggtatttatctgaatatccagcttataaaaacaagaagagattgtcatttcaacagcaccagcaactcttcctgtgatttacagaggcaataaagaactagagggggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]