GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-09-08 09:32:06, GGRNA.v2 : RefSeq release 225 (Jul, 2024)

LOCUS       XR_009214237             343 bp    RNA     linear   PRI 26-JUL-2023
DEFINITION  PREDICTED: Hylobates moloch uncharacterized LOC131383852
            (LOC131383852), ncRNA.
ACCESSION   XR_009214237
VERSION     XR_009214237.1
DBLINK      BioProject: PRJNA600985
KEYWORDS    RefSeq.
SOURCE      Hylobates moloch (silvery gibbon)
  ORGANISM  Hylobates moloch
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hylobatidae; Hylobates.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026652281) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_009828535.3-RS_2023_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/21/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..343
                     /organism="Hylobates moloch"
                     /mol_type="transcribed RNA"
                     /isolate="HMO894"
                     /isolation_source="EBV transformed lymphoblastoid cell
                     line"
                     /db_xref="taxon:81572"
                     /chromosome="Unknown"
                     /sex="male"
                     /note="Lionel"
     gene            1..343
                     /gene="LOC131383852"
                     /note="uncharacterized LOC131383852; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:131383852"
     ncRNA           1..343
                     /ncRNA_class="lncRNA"
                     /gene="LOC131383852"
                     /product="uncharacterized LOC131383852"
                     /db_xref="GeneID:131383852"
ORIGIN      
agcagagggagacatctgaccatggacacagtattgctacttgccagtattctaatttcagatcctgggacctgagattgaaccggcagctgatcaattctgtggaatttagagttcttgttctcggcactgaaccagaattttctttggcaaaagagggaaagcatacaattatggtcagaaacataataataaatccactgtaacaaccttctttccaccacatatctttgctggtatttatctgaatatccagcttataaaaacaagaagagattgtcatttcaacagcaccagcaactcttcctgtgatttacagaggcaataaagaactagagggggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]