GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-10-23 02:06:08, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_008332942             394 bp    RNA     linear   VRT 26-FEB-2023
DEFINITION  PREDICTED: Podarcis raffonei uncharacterized LOC128424167
            (LOC128424167), ncRNA.
ACCESSION   XR_008332942
VERSION     XR_008332942.1
DBLINK      BioProject: PRJNA928705
KEYWORDS    RefSeq.
SOURCE      Podarcis raffonei (Aeolian wall lizard)
  ORGANISM  Podarcis raffonei
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Laterata; Lacertibaenia; Lacertidae; Podarcis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_070613) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_027172205.1-RS_2023_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/25/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..394
                     /organism="Podarcis raffonei"
                     /mol_type="transcribed RNA"
                     /isolate="rPodRaf1"
                     /specimen_voucher="LC15"
                     /db_xref="taxon:65483"
                     /chromosome="12"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="Italy: Stromboli Island"
                     /lat_lon="38.788175 N 15.229709 E"
                     /collection_date="2020-07-01"
                     /collected_by="Claudio Ciofi"
     gene            1..394
                     /gene="LOC128424167"
                     /note="uncharacterized LOC128424167; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:128424167"
     ncRNA           1..394
                     /ncRNA_class="lncRNA"
                     /gene="LOC128424167"
                     /product="uncharacterized LOC128424167"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:128424167"
ORIGIN      
ggtggggagagaaggagactctcctgagggcaacagtgagagaagggaacttgccagtggcccatctagtcctggatcctgttctcacagtggccaacaggcatcaatttacacttatttacattgtttatgttgaattgcacttgccattttattacccattcactcaggttggagagcttgttttcacaatctcttcttgtttgaatgaccctgaacaatttagcatcatcggcaaacttcactgctcacccctaattctcaattgtttttgaacaagttaaatagcagaggtctcagtgttgatctttttaaaataaaaaataaaataaggtgttgttaaagttttttcataatacaataagataaaagaaactaaataaaaacaaaaaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]