GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-24 00:36:06, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       XR_008031621            1038 bp    RNA     linear   INV 29-NOV-2022
DEFINITION  PREDICTED: Dreissena polymorpha uncharacterized LOC127842430
            (LOC127842430), ncRNA.
ACCESSION   XR_008031621
VERSION     XR_008031621.1
DBLINK      BioProject: PRJNA903932
KEYWORDS    RefSeq.
SOURCE      Dreissena polymorpha
  ORGANISM  Dreissena polymorpha
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Heteroconchia; Euheterodonta; Imparidentia;
            Neoheterodontei; Myida; Dreissenoidea; Dreissenidae; Dreissena.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_068362) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: Dreissena polymorpha Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1038
                     /organism="Dreissena polymorpha"
                     /mol_type="transcribed RNA"
                     /isolate="Duluth1"
                     /db_xref="taxon:45954"
                     /chromosome="8"
                     /sex="male"
                     /tissue_type="Whole animal"
                     /dev_stage="adult"
                     /country="USA: Lake Superior, Duluth, MN"
                     /lat_lon="46.78671 N 92.09114 W"
                     /collection_date="2017-06"
     gene            1..1038
                     /gene="LOC127842430"
                     /note="uncharacterized LOC127842430; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:127842430"
     ncRNA           1..1038
                     /ncRNA_class="lncRNA"
                     /gene="LOC127842430"
                     /product="uncharacterized LOC127842430"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:127842430"
ORIGIN      
gttaaagttcttatttcatggtataactttggtatgcttggacctagagtcttcaaacttgacatgaaggttggccaggattaacagatgaccactggtcatttcaaggtcattcatttgaaggtgaaggtcactgtgaccttcaatataaaaatgttaaagttgttataactttggtatgcttggacctagagtcttgaaacttgacatgaaggttggccagaactagtaagtaaccactggacatttcaaggtcattcatttgaaggtcaaggtcactgtgaccttgaatgtaaaaatgttaaagttgttataactttggtatgcttggacctagtcttgaaacttgacatgaaggttggccagaactagtaagtaaccactggacatttcaaggtcattcatttgaaggtcaaggtcactgtgaccttgaatgtaaaaatgttaaagttcttatttcatgttataactttggtatgcttgtacctagagtcttcaaacttgacataaaggttggccagtactagaagatcaccactgctcatttcaatgtcattcatttgaaggtcaaggtcactgtgaccttcaatgttaaaatgttaaaattgttataactttggtacgcttggacctagaatctcaaacttgacgtaaaggtttgcaagcacacttagatgaccactggtcatttcaaggtcattcatttcaatgtcattcatttgaaggtcaaggtcactgtgaacttaaatgttaaaatgttaaaattgttgtaactttggtatgcttggacctagaatctcaaacttgacgtaaaggtttgcaagcacacttagatgaccactggtcatttcaaggtcattcatttgaaggtcgaggtcactgtgaccttggatgtaaatatgttaaagttgttaatactttggtatgcttagacctagagtcttcaaacttgatatgaaggttggccagaactagtagatgaccactggtcattttaaggtcaaggtcaccgtgaccttgaatgtaaaaatgttaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]