ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-24 11:47:35, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_006334132 148 bp RNA linear PLN 28-SEP-2021
DEFINITION PREDICTED: Telopea speciosissima uncharacterized LOC122670138
(LOC122670138), ncRNA.
ACCESSION XR_006334132
VERSION XR_006334132.1
DBLINK BioProject: PRJNA765358
KEYWORDS RefSeq.
SOURCE Telopea speciosissima
ORGANISM Telopea speciosissima
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Proteales; Proteaceae; Telopea.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_057922.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Telopea speciosissima Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 9.0
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..148
/organism="Telopea speciosissima"
/mol_type="transcribed RNA"
/isolate="NSW1024214"
/db_xref="taxon:54955"
/chromosome="7"
/tissue_type="leaf"
/dev_stage="Mature"
/ecotype="Mountain lineage"
/geo_loc_name="Australia: Blue Mountains Botanic Garden,
Mount Tomah, NSW"
/lat_lon="33.53211 S 150.41949 E"
/collection_date="2019-05-30"
gene 1..148
/gene="LOC122670138"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 14 samples
with support for all annotated introns"
/db_xref="GeneID:122670138"
ncRNA 1..148
/ncRNA_class="lncRNA"
/gene="LOC122670138"
/product="uncharacterized LOC122670138"
/db_xref="GeneID:122670138"
ORIGIN
tttctacaagagatggtgtgcgaaacagtttttaatggaaaggaagaacttagtcaatctcttcttgaaagcaagcgaggaagacaagctgaaggtattggaattgtatatgccagatactgaggacatcaatgaagactgatgaatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]