2025-09-17 13:05:26, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_006333008 304 bp RNA linear PLN 28-SEP-2021 DEFINITION PREDICTED: Telopea speciosissima uncharacterized LOC122662367 (LOC122662367), ncRNA. ACCESSION XR_006333008 VERSION XR_006333008.1 DBLINK BioProject: PRJNA765358 KEYWORDS RefSeq. SOURCE Telopea speciosissima ORGANISM Telopea speciosissima Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Proteales; Proteaceae; Telopea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_057920.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Telopea speciosissima Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..304 /organism="Telopea speciosissima" /mol_type="transcribed RNA" /isolate="NSW1024214" /db_xref="taxon:54955" /chromosome="5" /tissue_type="leaf" /dev_stage="Mature" /ecotype="Mountain lineage" /geo_loc_name="Australia: Blue Mountains Botanic Garden, Mount Tomah, NSW" /lat_lon="33.53211 S 150.41949 E" /collection_date="2019-05-30" gene 1..304 /gene="LOC122662367" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:122662367" ncRNA 1..304 /ncRNA_class="lncRNA" /gene="LOC122662367" /product="uncharacterized LOC122662367" /db_xref="GeneID:122662367" ORIGIN
acagaacaaactcactcttactgaaaatcaagtttcgggggtgaatgtcttctcgcaaggtttctctggaaatcattttaaggggaaatcttctttccagaaacctgcttatagtttcctagagtccgtgctgccggggaaatcatcttcagcaaaaaccagttatttgcagggaagagagtggaaatgatatacgtggacatcttcaatctcttcttgtactaaatgtttctcaacaagagagacatgtgctgtaagcctgtaactgcgaagaattagatctcgaagggatctatttcgtttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]