LOCUS       XR_005781792             818 bp    RNA     linear   MAM 01-APR-2021
DEFINITION  PREDICTED: Puma yagouaroundi uncharacterized LOC121011838
            (LOC121011838), ncRNA.
ACCESSION   XR_005781792
VERSION     XR_005781792.1
DBLINK      BioProject: PRJNA717316
KEYWORDS    RefSeq.
SOURCE      Puma yagouaroundi (jaguarundi)
  ORGANISM  Puma yagouaroundi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Puma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024412426.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Puma yagouaroundi Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..818
                     /organism="Puma yagouaroundi"
                     /mol_type="transcribed RNA"
                     /isolation_source="originally collected by Mitchell Bush
                     (The Center for Species Survival, Department of
                     Reproductive Sciences, Smithsonian Conservation Biology
                     Institute, Smithsonian's National Zoological Park, 1500
                     Remount Road, Front Royal, VA 22630, USA) from Blijdorp
                     Zoo, Rotterdam, Netherlands (Director Dirk Van Dam) from a
                     breeding male juguarundi from Mexico"
                     /db_xref="taxon:1608482"
                     /chromosome="Unknown"
                     /sex="male"
                     /cell_line="HYA-1"
                     /tissue_type="fibroblast cell line, passage 10"
                     /ecotype="Mexico"
                     /collection_date="Dec-1981"
     gene            1..818
                     /gene="LOC121011838"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 14 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:121011838"
     ncRNA           1..818
                     /ncRNA_class="lncRNA"
                     /gene="LOC121011838"
                     /product="uncharacterized LOC121011838"
                     /db_xref="GeneID:121011838"
ORIGIN      

tttttcttagcatgtcagaacgttgggtaacattatctccattttaaacaaaagaaaactaaagctctgagaaggaaaatgtcttcctcaaattcaaatacattcagctggctgcagttatattttgctcactgttatagcctcaggatctttcagagtcactggaatatgtcttgcacctgttctgctctggcgcaggattgttgaagatggcagaggagaaatggacgtgcccagaagaggagcagagccccacaccaccgtgaagggcttgggcatcagcgatcatgatttctctgcatctcctcacggtgctcaacgaatataaaacagcagcagttcccagctcagagaccccaccctgaaatattccccaccaaagtcaagcgggctgcaaataacctgagggagcaatgatttcccttcccgaagccctcgggatcaattagaactaatcaaagatttggcccaagaattataaattggaattgatataaagtacttcacttccaaacacctcattcttcccaaaatgatgattcaaataattgacattctgaatgagactgaaaaatgtgctttgggaagaagatgagattcctttgccgaacaatagattcagtatttttggaatgactgagaacaacaaagataaaatacccaaacctacctcatgagtcagtcaagctaaaaaaccagacgttgccattatccaagttaagcgaacaatgctttcttaattatttgttctaatcagtcaaaggtcagcatgacctaggatctgactctaagtctgctgaagagaaaacaccttaaaa

//