2025-09-18 04:42:37, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_005781792 818 bp RNA linear MAM 01-APR-2021 DEFINITION PREDICTED: Puma yagouaroundi uncharacterized LOC121011838 (LOC121011838), ncRNA. ACCESSION XR_005781792 VERSION XR_005781792.1 DBLINK BioProject: PRJNA717316 KEYWORDS RefSeq. SOURCE Puma yagouaroundi (jaguarundi) ORGANISM Puma yagouaroundi Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae; Felinae; Puma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024412426.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Puma yagouaroundi Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..818 /organism="Puma yagouaroundi" /mol_type="transcribed RNA" /isolation_source="originally collected by Mitchell Bush (The Center for Species Survival, Department of Reproductive Sciences, Smithsonian Conservation Biology Institute, Smithsonian's National Zoological Park, 1500 Remount Road, Front Royal, VA 22630, USA) from Blijdorp Zoo, Rotterdam, Netherlands (Director Dirk Van Dam) from a breeding male juguarundi from Mexico" /db_xref="taxon:1608482" /chromosome="Unknown" /sex="male" /cell_line="HYA-1" /tissue_type="fibroblast cell line, passage 10" /ecotype="Mexico" /collection_date="Dec-1981" gene 1..818 /gene="LOC121011838" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 14 samples with support for all annotated introns" /db_xref="GeneID:121011838" ncRNA 1..818 /ncRNA_class="lncRNA" /gene="LOC121011838" /product="uncharacterized LOC121011838" /db_xref="GeneID:121011838" ORIGIN
tttttcttagcatgtcagaacgttgggtaacattatctccattttaaacaaaagaaaactaaagctctgagaaggaaaatgtcttcctcaaattcaaatacattcagctggctgcagttatattttgctcactgttatagcctcaggatctttcagagtcactggaatatgtcttgcacctgttctgctctggcgcaggattgttgaagatggcagaggagaaatggacgtgcccagaagaggagcagagccccacaccaccgtgaagggcttgggcatcagcgatcatgatttctctgcatctcctcacggtgctcaacgaatataaaacagcagcagttcccagctcagagaccccaccctgaaatattccccaccaaagtcaagcgggctgcaaataacctgagggagcaatgatttcccttcccgaagccctcgggatcaattagaactaatcaaagatttggcccaagaattataaattggaattgatataaagtacttcacttccaaacacctcattcttcccaaaatgatgattcaaataattgacattctgaatgagactgaaaaatgtgctttgggaagaagatgagattcctttgccgaacaatagattcagtatttttggaatgactgagaacaacaaagataaaatacccaaacctacctcatgagtcagtcaagctaaaaaaccagacgttgccattatccaagttaagcgaacaatgctttcttaattatttgttctaatcagtcaaaggtcagcatgacctaggatctgactctaagtctgctgaagagaaaacaccttaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]