GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-23 04:48:08, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XR_005781792             818 bp    RNA     linear   MAM 01-AUG-2025
DEFINITION  PREDICTED: Herpailurus yagouaroundi uncharacterized LOC121011838
            (LOC121011838), ncRNA.
ACCESSION   XR_005781792
VERSION     XR_005781792.1
DBLINK      BioProject: PRJNA717316
KEYWORDS    RefSeq.
SOURCE      Herpailurus yagouaroundi (jaguarundi)
  ORGANISM  Herpailurus yagouaroundi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Herpailurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024412426.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_014898765.1-RS_2025_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/31/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..818
                     /organism="Herpailurus yagouaroundi"
                     /mol_type="transcribed RNA"
                     /isolation_source="originally collected by Mitchell Bush
                     (The Center for Species Survival, Department of
                     Reproductive Sciences, Smithsonian Conservation Biology
                     Institute, Smithsonian's National Zoological Park, 1500
                     Remount Road, Front Royal, VA 22630, USA) from Blijdorp
                     Zoo, Rotterdam, Netherlands (Director Dirk Van Dam) from a
                     breeding male juguarundi from Mexico"
                     /db_xref="taxon:1608482"
                     /chromosome="Unknown"
                     /sex="male"
                     /cell_line="HYA-1"
                     /tissue_type="fibroblast cell line, passage 10"
                     /ecotype="Mexico"
                     /collection_date="Dec-1981"
     gene            1..818
                     /gene="LOC121011838"
                     /note="uncharacterized LOC121011838; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 14 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:121011838"
     ncRNA           1..818
                     /ncRNA_class="lncRNA"
                     /gene="LOC121011838"
                     /product="uncharacterized LOC121011838"
                     /db_xref="GeneID:121011838"
ORIGIN      
tttttcttagcatgtcagaacgttgggtaacattatctccattttaaacaaaagaaaactaaagctctgagaaggaaaatgtcttcctcaaattcaaatacattcagctggctgcagttatattttgctcactgttatagcctcaggatctttcagagtcactggaatatgtcttgcacctgttctgctctggcgcaggattgttgaagatggcagaggagaaatggacgtgcccagaagaggagcagagccccacaccaccgtgaagggcttgggcatcagcgatcatgatttctctgcatctcctcacggtgctcaacgaatataaaacagcagcagttcccagctcagagaccccaccctgaaatattccccaccaaagtcaagcgggctgcaaataacctgagggagcaatgatttcccttcccgaagccctcgggatcaattagaactaatcaaagatttggcccaagaattataaattggaattgatataaagtacttcacttccaaacacctcattcttcccaaaatgatgattcaaataattgacattctgaatgagactgaaaaatgtgctttgggaagaagatgagattcctttgccgaacaatagattcagtatttttggaatgactgagaacaacaaagataaaatacccaaacctacctcatgagtcagtcaagctaaaaaaccagacgttgccattatccaagttaagcgaacaatgctttcttaattatttgttctaatcagtcaaaggtcagcatgacctaggatctgactctaagtctgctgaagagaaaacaccttaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]