2024-04-25 07:17:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005541109 148 bp RNA linear PLN 29-JAN-2021 DEFINITION PREDICTED: Dioscorea cayenensis subsp. rotundata uncharacterized LOC120275457 (LOC120275457), ncRNA. ACCESSION XR_005541109 VERSION XR_005541109.1 DBLINK BioProject: PRJNA695139 KEYWORDS RefSeq. SOURCE Dioscorea cayenensis subsp. rotundata (Guinea yam) ORGANISM Dioscorea cayenensis subsp. rotundata Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Dioscoreales; Dioscoreaceae; Dioscorea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052484.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Dioscorea cayenensis subsp. rotundata Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..148 /organism="Dioscorea cayenensis subsp. rotundata" /mol_type="transcribed RNA" /cultivar="TDr96_F1" /sub_species="rotundata" /db_xref="taxon:55577" /chromosome="14" /country="Japan:Iwate" /collection_date="2016-06-01" gene 1..148 /gene="LOC120275457" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:120275457" ncRNA 1..148 /ncRNA_class="lncRNA" /gene="LOC120275457" /product="uncharacterized LOC120275457" /db_xref="GeneID:120275457" ORIGIN
tgaaacccaaatcatgttttatgtttatggttgtagtaatgttcttcgtcatgtataagttgacaaaattccaacaggcacaagaagagattgaatcagtatctcagacttttgattccatgatgaggaggacaccaaagaagctgta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]