2024-04-26 12:03:23, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_005206202 328 bp RNA linear VRT 19-NOV-2020 DEFINITION PREDICTED: Sebastes umbrosus uncharacterized LOC119485163 (LOC119485163), ncRNA. ACCESSION XR_005206202 VERSION XR_005206202.1 DBLINK BioProject: PRJNA675852 KEYWORDS RefSeq. SOURCE Sebastes umbrosus (honeycomb rockfish) ORGANISM Sebastes umbrosus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Perciformes; Scorpaenoidei; Sebastidae; Sebastinae; Sebastes. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051269.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Sebastes umbrosus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..328 /organism="Sebastes umbrosus" /mol_type="transcribed RNA" /isolate="fSebUmb1" /db_xref="taxon:72105" /chromosome="1" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="USA: California coast" /lat_lon="33.599833 N 118.265167 W" /collection_date="05-Oct-2017" /collected_by="University of Washington" gene 1..328 /gene="LOC119485163" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:119485163" ncRNA 1..328 /ncRNA_class="lncRNA" /gene="LOC119485163" /product="uncharacterized LOC119485163" /db_xref="GeneID:119485163" ORIGIN
tgggtgtatgcttgtattcttgtttatactacctatgttcttatgtttatgcctacatttgtatattttgtctttaaatgtaaagcactttgaaattacgtggaatgaaatgtgctatataaactagaattaccgcctcacggttgtatgcctcagccaaccagtcaagttccagtttacatccccgtctgtccgaaatgtcatcacctcattattttatcctattagacatttgtgtaaagttgtcataagtagcacatgaattcttgagttatggccaaaaacgtgttttgtgaggtcacagtgacctttgaccaccaaaatctgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]