ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-03-04 17:24:50, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_005206202 328 bp RNA linear VRT 19-NOV-2020
DEFINITION PREDICTED: Sebastes umbrosus uncharacterized LOC119485163
(LOC119485163), ncRNA.
ACCESSION XR_005206202
VERSION XR_005206202.1
DBLINK BioProject: PRJNA675852
KEYWORDS RefSeq.
SOURCE Sebastes umbrosus (honeycomb rockfish)
ORGANISM Sebastes umbrosus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Eupercaria; Perciformes; Scorpaenoidei;
Sebastidae; Sebastinae; Sebastes.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_051269.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Sebastes umbrosus Annotation Release
100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..328
/organism="Sebastes umbrosus"
/mol_type="transcribed RNA"
/isolate="fSebUmb1"
/db_xref="taxon:72105"
/chromosome="1"
/sex="male"
/tissue_type="muscle"
/dev_stage="adult"
/geo_loc_name="USA: California coast"
/lat_lon="33.599833 N 118.265167 W"
/collection_date="05-Oct-2017"
/collected_by="University of Washington"
gene 1..328
/gene="LOC119485163"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:119485163"
ncRNA 1..328
/ncRNA_class="lncRNA"
/gene="LOC119485163"
/product="uncharacterized LOC119485163"
/db_xref="GeneID:119485163"
ORIGIN
tgggtgtatgcttgtattcttgtttatactacctatgttcttatgtttatgcctacatttgtatattttgtctttaaatgtaaagcactttgaaattacgtggaatgaaatgtgctatataaactagaattaccgcctcacggttgtatgcctcagccaaccagtcaagttccagtttacatccccgtctgtccgaaatgtcatcacctcattattttatcctattagacatttgtgtaaagttgtcataagtagcacatgaattcttgagttatggccaaaaacgtgttttgtgaggtcacagtgacctttgaccaccaaaatctgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]