GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-16 05:57:06, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_005206202             328 bp    RNA     linear   VRT 19-NOV-2020
DEFINITION  PREDICTED: Sebastes umbrosus uncharacterized LOC119485163
            (LOC119485163), ncRNA.
ACCESSION   XR_005206202
VERSION     XR_005206202.1
DBLINK      BioProject: PRJNA675852
KEYWORDS    RefSeq.
SOURCE      Sebastes umbrosus (honeycomb rockfish)
  ORGANISM  Sebastes umbrosus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Scorpaenoidei;
            Sebastidae; Sebastinae; Sebastes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051269.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sebastes umbrosus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..328
                     /organism="Sebastes umbrosus"
                     /mol_type="transcribed RNA"
                     /isolate="fSebUmb1"
                     /db_xref="taxon:72105"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="USA: California coast"
                     /lat_lon="33.599833 N 118.265167 W"
                     /collection_date="05-Oct-2017"
                     /collected_by="University of Washington"
     gene            1..328
                     /gene="LOC119485163"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:119485163"
     ncRNA           1..328
                     /ncRNA_class="lncRNA"
                     /gene="LOC119485163"
                     /product="uncharacterized LOC119485163"
                     /db_xref="GeneID:119485163"
ORIGIN      
tgggtgtatgcttgtattcttgtttatactacctatgttcttatgtttatgcctacatttgtatattttgtctttaaatgtaaagcactttgaaattacgtggaatgaaatgtgctatataaactagaattaccgcctcacggttgtatgcctcagccaaccagtcaagttccagtttacatccccgtctgtccgaaatgtcatcacctcattattttatcctattagacatttgtgtaaagttgtcataagtagcacatgaattcttgagttatggccaaaaacgtgttttgtgaggtcacagtgacctttgaccaccaaaatctgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]