2024-04-20 01:17:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004992820 655 bp RNA linear INV 06-OCT-2020 DEFINITION PREDICTED: Rhagoletis pomonella uncharacterized LOC118737489 (LOC118737489), transcript variant X2, ncRNA. ACCESSION XR_004992820 VERSION XR_004992820.1 DBLINK BioProject: PRJNA666774 KEYWORDS RefSeq. SOURCE Rhagoletis pomonella (apple maggot) ORGANISM Rhagoletis pomonella Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Tephritoidea; Tephritidae; Rhagoletis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023458558.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Rhagoletis pomonella Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..655 /organism="Rhagoletis pomonella" /mol_type="transcribed RNA" /isolate="Grant_MI" /host="apple trees" /db_xref="taxon:28610" /chromosome="Unknown" /sex="pooled male and female" /tissue_type="whole body" /dev_stage="adult" /country="USA: Grant, Michigan" /collection_date="2010" gene 1..655 /gene="LOC118737489" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:118737489" ncRNA 1..655 /ncRNA_class="lncRNA" /gene="LOC118737489" /product="uncharacterized LOC118737489, transcript variant X2" /db_xref="GeneID:118737489" ORIGIN
aaaaaggaatttttaagttttcagaaggttatgatcttcatctttgctgtttgtaagctacgtcatattagagtatgtacatagataagaaggcaggaaaataaagctggtaaatattcagatgaaaacgatgtcggtcgaattccgaaaaaccttcacgaattacttatatacatatgaatgtatgtatgtaggtcatcatgaccttcttgaatctgtttaaaccattacggtatgtctcggatcaatgtatgtagctcgatagagaacactcttcggttttcttttcgccgagaagtctcagttgttttacactggcggaagaactactttacgattaaaaagtatataaatcaatgctgcgtttagcgccatattcccccatgctaaaccccattgaaataatctggggaaaaatcaaaatgcatgtaaaggtgcacatctcaaacccagtcataaatgggccaaacgttgtttagcaacggctgcaatatttggagaagttggtggatcacgcgaaaactataatcaccggaggagactgcgcgaaatgctttatctttacaagatatgcaagttgggacataataaacttgcatttttaataacatctaaataatttctgaataaaaacgagtttctcatttccaaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]