GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 17:46:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_004992819             643 bp    RNA     linear   INV 06-OCT-2020
DEFINITION  PREDICTED: Rhagoletis pomonella uncharacterized LOC118737489
            (LOC118737489), transcript variant X1, ncRNA.
ACCESSION   XR_004992819
VERSION     XR_004992819.1
DBLINK      BioProject: PRJNA666774
KEYWORDS    RefSeq.
SOURCE      Rhagoletis pomonella (apple maggot)
  ORGANISM  Rhagoletis pomonella
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Brachycera;
            Muscomorpha; Tephritoidea; Tephritidae; Rhagoletis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023458558.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rhagoletis pomonella Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..643
                     /organism="Rhagoletis pomonella"
                     /mol_type="transcribed RNA"
                     /isolate="Grant_MI"
                     /host="apple trees"
                     /db_xref="taxon:28610"
                     /chromosome="Unknown"
                     /sex="pooled male and female"
                     /tissue_type="whole body"
                     /dev_stage="adult"
                     /country="USA: Grant, Michigan"
                     /collection_date="2010"
     gene            1..643
                     /gene="LOC118737489"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 9 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:118737489"
     ncRNA           1..643
                     /ncRNA_class="lncRNA"
                     /gene="LOC118737489"
                     /product="uncharacterized LOC118737489, transcript variant
                     X1"
                     /db_xref="GeneID:118737489"
ORIGIN      
aaaaaggaatttttaagttttcagaaggttatgatcttcatctttgctgtttgtaagctacgtcatattagagtatgtacatagataagaaggcaggaaaataaagctggtaaatattcagatgaaaacgatgtcggtcgaattccgaaaaaccttcacgaattacttatatacatatgaatgtatgtatgtaggtcatcatgaccttcttgaatctgtttaaaccattacggtatgtctcggatcaatgtatgtagctcgatagagaacactcttcggttttcttttcgccgagaagtctcagttgttttacactggcggaagaactactttacgattaaaaagtatataaatcaacgccatattcccccatgctaaaccccattgaaataatctggggaaaaatcaaaatgcatgtaaaggtgcacatctcaaacccagtcataaatgggccaaacgttgtttagcaacggctgcaatatttggagaagttggtggatcacgcgaaaactataatcaccggaggagactgcgcgaaatgctttatctttacaagatatgcaagttgggacataataaacttgcatttttaataacatctaaataatttctgaataaaaacgagtttctcatttccaaatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]