GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 01:11:08, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_004751278            3630 bp    RNA     linear   VRT 05-JUL-2020
DEFINITION  PREDICTED: Oxyura jamaicensis NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X3,
            misc_RNA.
ACCESSION   XR_004751278
VERSION     XR_004751278.1
DBLINK      BioProject: PRJNA641662
KEYWORDS    RefSeq.
SOURCE      Oxyura jamaicensis (ruddy duck)
  ORGANISM  Oxyura jamaicensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes;
            Anatidae; Anatinae; Oxyura.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_048897.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oxyura jamaicensis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3630
                     /organism="Oxyura jamaicensis"
                     /mol_type="transcribed RNA"
                     /isolate="SHBP4307"
                     /db_xref="taxon:8884"
                     /chromosome="5"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="USA: Scotland Neck, NC"
                     /breed="ruddy duck"
     gene            1..3630
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 41 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:118167874"
     misc_RNA        1..3630
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:118167874"
ORIGIN      
gagggaaaatgggatgacgaggaaggaaaagctgcctctggctatggaaactccatcctcggctcctccccgcgggctgaacagtaatcccctccttcagtcccatcagcggaggcccggagaatgcgcgacgcccccaccacagacactttccgcgcccagcacccacgccggtccggccgccattttgggagccaaggcagacgaactacatctcccagcaggcccggcgccgcggcgccatcttgccccttcgctccgcggggcagttcgggcagccagcgcgggcggtgagcggggctatggcgctgttcccggcctttgccggtgccgcggagcctggggagacctcagccggcagcagcgaaggctccagaaaagacctggactggctgagtaacccaagcttctctacagaagatgcactgttagtgcatcaacgcacaacagaaattgcaaattctacccctggaaaatcaccactaataagcaggacttcttcaagatcagagctgtcaggggaaagtgattcagatgagaatctgaaaaagtcaagtaagaaaaggaaaaagaaaaagaaaaagcatcaccactataagacaaaaaagaaagccaaaggggactccagtagcagcgaaccagacttggacactaagcacgtcaaggacaaagcgacagcaagtggcagaaatcgcgaaaaggaagcagcagcaaatctaggtgataaaacatcaaatcttaccaacaaccgctttgtttggcttgatgatatccaggctttcacagcagaaaccttcagaatagacaagaaatcagatcctgcaaactgggcctacaaatccctgtatcgaggggacattgcaagatataaaaggaaaggagagtcctgtcttggcatagatgcaaagaaacaatgtataacttgggacagtcctgcatcccaaaagaagcaatcacagaggcgacctgagcgctacttttcaaagaacaatgtgaagacgttaaacacagatgggattcctgtttgcagtaaaagttctccatctgactcagctgcttttataccagttttccaagtggaaagcagtgatccttctgacacaacagaggtaaaccctcttgggatttatgatccatcaactacagtgtggctacaaggaaaaggatacaaaggttcagaacatgagcctgaaaatacccagcaggcatttcaggagtctgggataaatgttaaccccattctaatgacaaaagtggaagaatataacaagaaagtcagagaaaacccaagagatattaatgcttggatggaatttgtttcttttcaggatgaattaatgagaggacctagcccctatgcaagtatgggagagcaggaagtaagaagaaaatccctgaagttaatcttagaaaagaaactagctattttagagagggcaattgaaagcaatccaagtaatgttgacctgaaacttgccaggttgaaggtttgcacagaattctgggaaccgccagctttgatcaaagaatggcagaagctaattttcatacatcccaataacccagagctgtggaagaaatatcttctgttctgtcaaagtcagttcagtaccttttctgtttcaaaaatcaatgggctctacggaaaatgcttgactacactggcagctgtacaggatggcagcatggtatcacatcctccactgccaggcacagaagaagctatgctagctatatttattcagcaatgccactttctgaggcaggctggccattctgagaaagcggtgtctttgtttcaggctctgattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaagggacaggtggagttctttgagcctttttgggatagtggagaaccacgaattggagaaaaaggagcaagaggctggagggcatggatgcaccaacaagaaaagggtggctggattgctgttgacaaacctgatgatgatgatgaagaagagatagatgaagatgaagaaataaaggataaaactcttcccaagtggcacatttggctggatattgaatattctcgtgaagcaagacattggttaccttggaggccagacaaaaccaaaaagcaaactgaagaagactgtgaagatccagaaagacaggtgttatttgatgatctcggaccatccatgatccagctttctaatccagaccttcaacatcaactactgtactcatttttgcaattcctaggagtgccatgtataagtaagctctttcctcccaacctctatattgccatggatgaaaataacatctttgacaatgtactttccgatgaaaagccactgacttctattgatgtgccactgtctggattcaacactattggtcacatggacacgatgctaagaggcagacagcatatcggccactataaagatggagaggagttcatacagaatgtttttcatgctctatacctgctgttttcaggaaaggaaaaatctaacctgtccatttgttggttacagtatgaaatatctaaggtagttcagtgtctccaaacaaaaaacaagaagaagctgaaagcacaagggaggaaaagtaaaaaattggccaagaatctccttaaagcacctgacaaccgaaatgacctttctctctggaaactgtatgcctacctagaatggctgcttggcaacatcgatgatgctaggaaggtatttgacacagctctgagcacagcagagacaggaggattgaagagtcccaagctgtgcagcctcagtctgctttatgctcagctggaagtggaactactggaaagcctggaaggagctgtcacatcacgcgctgttcatatattgactaaattgactgaaagtggaccatatgtgccctataaaggacaagtgttatctgttaatgtcttgaaagctcgtaagacttatgagcatgcagtgcaagattatttaagtaaaacaccggtttctgatcgggatcaggttggtgagtctaaccagctggttaacttggttggttgttatgcagtgttccagtacttgactgttgggattgatgctgcggtattaatatatacacaggcttcggaaaagcttcaggttcctgctccagagaaatgtgaaaataccggagcaaattctggcattcaaaatcttcccagtgctcttgaagctgtcacactgctgcacacaaatttactcaggttccacgtgaaaattagcgtttatcctttgaatcctttgcgagaggccctaacggaggcactgaggcgatatcctagcaaccagtccctctggaggtcgtacgtccacgtccaaaggaagtctcacagtgctagcaaagcacgaaggttttttgacggtgtcacaaggtctaccagctctttagagccgtggctgtttgcaatccaagcagagcagatgagaaaaaaacttactgagcatgtccagagatgttggtgaaatatattccactattcctgaaactgggttaacaaataggattattgctctatttgaacatgcaattcagagtgaaaatggtacccattgtccgctgctgtggaggatgtatttgaactttctggtttcagtaggaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]