GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 10:58:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_004613194             244 bp    RNA     linear   VRT 20-MAY-2020
DEFINITION  PREDICTED: Hippoglossus hippoglossus uncharacterized LOC117757739
            (LOC117757739), ncRNA.
ACCESSION   XR_004613194
VERSION     XR_004613194.1
DBLINK      BioProject: PRJNA627709
KEYWORDS    RefSeq.
SOURCE      Hippoglossus hippoglossus (Atlantic halibut)
  ORGANISM  Hippoglossus hippoglossus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei;
            Pleuronectidae; Hippoglossus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047173.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Hippoglossus hippoglossus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..244
                     /organism="Hippoglossus hippoglossus"
                     /mol_type="transcribed RNA"
                     /isolate="fHipHip1"
                     /db_xref="taxon:8267"
                     /chromosome="23"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Canada: Atlantic Ocean"
                     /lat_lon="44.63694 N 63.59167 W"
                     /collected_by="Tony Einfeldt"
     gene            1..244
                     /gene="LOC117757739"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 6 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:117757739"
     ncRNA           1..244
                     /ncRNA_class="lncRNA"
                     /gene="LOC117757739"
                     /product="uncharacterized LOC117757739"
                     /db_xref="GeneID:117757739"
ORIGIN      
gccaaaggtcaaaggtcacggtgacctcacagaacaaaaaatgagaaactgtcacagggaccccatataaatctggaaaaaaatacgcacacagtgcagtgtttctagttattgttattgtctgatccttttatataagaatggtaaagtctactgtcataatgtggtgttggttttaattcaagtattttatcaagtgtttcaatcattgaaatattgacataataaactgcatatatacaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]