GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:21:52, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_004348287            3857 bp    RNA     linear   MAM 27-FEB-2020
DEFINITION  PREDICTED: Phocoena sinus NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_004348287
VERSION     XR_004348287.1
DBLINK      BioProject: PRJNA606521
KEYWORDS    RefSeq.
SOURCE      Phocoena sinus (vaquita)
  ORGANISM  Phocoena sinus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Odontoceti; Phocoenidae; Phocoena.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045764.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Phocoena sinus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3857
                     /organism="Phocoena sinus"
                     /mol_type="transcribed RNA"
                     /isolate="mPhoSin1"
                     /db_xref="taxon:42100"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="Cultured fibroblasts (kidney)"
                     /country="Mexico: San Felipe, Baja California"
                     /lat_lon="31.103595 N 114.679383 W"
                     /collection_date="04-Nov-2017"
                     /collected_by="Frances Gulland"
     gene            1..3857
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 long SRA reads, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:116748450"
     misc_RNA        1..3857
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:116748450"
ORIGIN      
cgccatttttgtggagtgaaaaggcggtgtggcctgtgatcatggcgctgttcccggcctttgcgggtgttagtgaggagcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccataacatctctgagccaacaaactgaagaggtcacagcctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcagatgaaagtgacactaacaaaaagcccaaacaagcaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaggaaaaccaagagaaaacgtgggcagtcacgtagcagtggatctaaacgtgggcagtcaagtagcagtggatctgagtcatacactgattctgaaaaagacatatcttccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacaaagagaatgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtacgccatcgaggaaggacagcaggaaaagcagaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcaccgagttctgggagcccgccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccccgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggtggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcaacctttcattttccggcgtcagctgtgtcggacgcacggaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatctgcagcatcttccacctcgtgatgcctttgttttcagggaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagcccgacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggacgccagaagagttttcgatacagcactcggcatggcagggagcagagaactgaaggaccacgagctgtgtgagctcggtctcctctatgccgagctggaggtggaggtgttgccggacgttagaggggccgccccagcccgagccattcacgtattgaccagactgaccgaggatggggcctacgggccctacaccgggcaagtcttggccattcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagccccccgagcctgagcagtgcccttgaggccgtcaccctgatgcacacgagtctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccggacaaccaggttctttggaggtcatatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagatggtagagaggtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtatttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgcttgaggactagagactaccaggagggtagtggggtgtgcctccgaggcctcggcgccggccccgtgggagcaggagataccagaagagacggcgacacatgcgtgcgagtgtgttaagacctctgcctttggagtttctttcttgatagtttgtgtctgggttatgggtctctcacctcttgtacattgtgtgtgcaaatgacacaaaagccatcgttttgcatattatatatgtatgtgtatatatgtgcatagacaggaatcatgctaagtgataaatgaacctgtcatggttggtgtgcga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]