2024-05-09 03:51:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004311999 330 bp RNA linear MAM 19-FEB-2020 DEFINITION PREDICTED: Camelus ferus uncharacterized LOC116657067 (LOC116657067), ncRNA. ACCESSION XR_004311999 VERSION XR_004311999.1 DBLINK BioProject: PRJNA605179 KEYWORDS RefSeq. SOURCE Camelus ferus (Wild Bactrian camel) ORGANISM Camelus ferus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda; Camelidae; Camelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045712.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Camelus ferus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..330 /organism="Camelus ferus" /mol_type="transcribed RNA" /isolate="YT-003-E" /db_xref="taxon:419612" /chromosome="17" /sex="male" /tissue_type="ear skin" /country="Mongolia" gene 1..330 /gene="LOC116657067" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:116657067" ncRNA 1..330 /ncRNA_class="lncRNA" /gene="LOC116657067" /product="uncharacterized LOC116657067" /db_xref="GeneID:116657067" ORIGIN
accacatcacaaacaaaagtcctaataaaagtcgctgactaggactatcctcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacacatgaaagagatgtatttgctcagggtctatcaatcttgttctgcctgttttctcaagtcagcagccttatctttacatttactccactcaatctcttcttgtcattttccctttctgtctgaaaataactacccccaagtctgcaaagcatcatctttgtattccatttcttgttgtaaagagtttgtgacattctgcgagatggacatgctagatcggaagagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]