ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-09 06:31:00, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_004311999 330 bp RNA linear MAM 19-FEB-2020
DEFINITION PREDICTED: Camelus ferus uncharacterized LOC116657067
(LOC116657067), ncRNA.
ACCESSION XR_004311999
VERSION XR_004311999.1
DBLINK BioProject: PRJNA605179
KEYWORDS RefSeq.
SOURCE Camelus ferus (Wild Bactrian camel)
ORGANISM Camelus ferus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
Camelidae; Camelus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_045712.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Camelus ferus Annotation Release 102
Annotation Version :: 102
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.3
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..330
/organism="Camelus ferus"
/mol_type="transcribed RNA"
/isolate="YT-003-E"
/db_xref="taxon:419612"
/chromosome="17"
/sex="male"
/tissue_type="ear skin"
/geo_loc_name="Mongolia"
gene 1..330
/gene="LOC116657067"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:116657067"
ncRNA 1..330
/ncRNA_class="lncRNA"
/gene="LOC116657067"
/product="uncharacterized LOC116657067"
/db_xref="GeneID:116657067"
ORIGIN
accacatcacaaacaaaagtcctaataaaagtcgctgactaggactatcctcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacacatgaaagagatgtatttgctcagggtctatcaatcttgttctgcctgttttctcaagtcagcagccttatctttacatttactccactcaatctcttcttgtcattttccctttctgtctgaaaataactacccccaagtctgcaaagcatcatctttgtattccatttcttgttgtaaagagtttgtgacattctgcgagatggacatgctagatcggaagagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]