GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 00:23:41, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       XR_004286082            4438 bp    RNA     linear   MAM 03-FEB-2020
DEFINITION  PREDICTED: Mustela erminea NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_004286082
VERSION     XR_004286082.1
DBLINK      BioProject: PRJNA602914
KEYWORDS    RefSeq.
SOURCE      Mustela erminea (ermine)
  ORGANISM  Mustela erminea
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Mustelidae; Mustelinae; Mustela.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045618.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mustela erminea Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4438
                     /organism="Mustela erminea"
                     /mol_type="transcribed RNA"
                     /isolate="mMusErm1"
                     /db_xref="taxon:36723"
                     /chromosome="5"
                     /sex="male"
                     /tissue_type="spleen (genome), liver, muscle, kidney"
                     /dev_stage="adult"
                     /country="New Zealand: Coromandel"
                     /lat_lon="37.304717 S 175.755071 E"
                     /collected_by="Andrew Veale, Tim Cruickshank"
     gene            1..4438
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 25 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116591631"
     misc_RNA        1..4438
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:116591631"
ORIGIN      
accgcgagcgcgaaggcctcactgtcggcgagcgctctccggcgccatttctgtagaggggaacggcagcgcggcctgtaatcatggcgctgttcccggcctttgcgggcattggtgaggctcccaatagcggcagcgccaggaaagaattagattggctgagcaacccgagcttttgtgctggagccgtaacctctctgagccaacagcctgaggaggccaccgccctggtttctgaagggtcatcgccgacgaggagtcctctgaaatcagagacttcagatgaaagtgacgctaacagaaagcccagacaaacaaccaggaaaaagaagaaagagaagaagaagaagaggaagcatcaccacaagaaaaccaagagaaaacgtgggcaggctagtagcagtggctccgagccggatagtgagcctgaaaaggacaaaacttccagaagcactggagacagtagaagggaatccgagaagccaaggcaagaaagtcatgctgctgctgatgttgggcatcgctttgtttggcttgaggacgtgcaggctctgacaggagaaaccttcagaacagacaagaaaccggatccggccaactgggagtataagtctctctaccgaggagacatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcctgggagggggcttccacagaaaagaagcattcgcacaagcacattgagcgctattttacgaagaagagcgtgggattgatgaacattgacggagttgccgtgggcagcaaaaccgaacctccgtcatctgagccgctctcctttatccccgtgaagggcccagatgatgcgcttcctcctgttacaacctggttgaaccctctgggcatttacgatcagtccaccacgcagtggttacaaggacagggtccttcagagcaagaatcaaagcagccagactcagagacggatagagagagcgcgctgctcaaggccaaggtggaggagttcaaccggagagtgcgcgagagtcctcgcgacgtgcagctgtggatggcctttgttgcttttcaggatgaggtcatgaaaagccctggcctgtacgccctcgaggagggagagccggagaagcggaagaggtctcggaagctggtgctggaccggaagctggccatcctggagcgggccatcgagagcaaccagagctccgtggagctgcagctggccaagctggagctgtgcgctgagttctgggagccctccgcgctgctcagggagtggcagaagctgatattcgtgcaccccaacaagacggccctgtggcagaagtaccttttattttgccaaagccagttcagcaccttcactgtcgccaagatccacggtctctatggcaagtgcttgagcacgctgtccgcggtgctggacggcagcatcctgtcgcaccctgcgctgccgggcaccgaggaggcggtgtttgctctctttcttcagcactgccacttcctgcggcaggctggccactcggagaaggccgtcgctctgttccaggccatggtggacttcaccttcttcaaacctgacagcgtgaaagacctgcctaccaaaggacaggtggagttctttgagcccttctgggacagtggggagccccgggctggggagaagggcgcccgcggctggagagcgtggatgcagcagcaggagcgaggtggctgggtggtcatcagtccagatgatgacgatgatgagccagaagacgaggaccaggaaatacgagataagagtctgcccaggtggcagatctggcttgccgctgagcggtcccgagaccagaggcactggcggccgtggcgccctgataagaccaggaagcaaaccgaggaagactgtgaagaccccgagagacaggtgctgttcgatgacatcgcacagtctctgatccagctctccagaccggatcttcagttccagctggtcacagcctttctgcagttcctgggtgtgccttgtggcttcagcaccccggcctcctgcgtctacttggccatggatgagaacagcatcttcgataacgggcttcatgatgaaaagccattgactttcctcaacctctccttcaatggcatcagctgtgttggccgctcagaccccctgggctgccgtcgctggacccgaggtcacagtcgagagggcgaggagttcatccgcaatgtctttcaccttgtgatgcctctgttttcaggccaggagaggtcccagctctgcttctcctggctacggtacgagatggcgaaggtcatttggtatctgcacactaaaaacaagaagaggttaaagtcacaaggaaagaactgcaaaaaactcgccaaaaatctccttaaggagccagaaaaccgcaacgatttctgcctctggaagcagtatgcacatctggagtggttgctcggcaacgcggaggacgccaggaaggtgtttgacgcggcgctcagcctggcgggcggcggggaaccgagggggtccgagctctgggagctcggcctcctctacgcgcagctggagctggagctggagctctcggccgaagtgagggggaccactgcggcccgggccgtgcacgtactgaccagactgacggagaatgggccctatgggccctactcggggccggtctcggccgttcatgtcctgaaagcccggaaggcttacgagcacgcgctgcaggactgcctggggcagagctgcggctccgctccagctcccgccagcccggctcaccgcctcgcgagcctggccaagtgcttcctgctcttccagtatgtgactgtaggcatcgaggcggccgtgcggctctacgagcaggtgtgtgcggggctgcggggctcggtgtgcccgggcggcgtactcgaggctgtcacgctgctgcacacgggcttgctccggttccacaccagggtccacgtttaccccctggctcccctgcgccaggcgctctcagaggcgatacagctatacccagacaaccagcttctctggagggcctacatacaggttcagagcaagtcccacgcagccagtaagaccagaaggttctttgatgctgttaccaggtccgccaaagccttggagccttggttgttcgcgattgaagctgagaaaatgaggaagaggctggtggagaccgttcagagggtggatggcagagagatccatgccacgattcccgagaccggcttggctcatcggatcagagccctgtttgaaagcacgttgcagagtgaccatggccgcctgtgccctttgctgtggagaatgtatttgaactttttggtttccttgggaaacaaagaaaggagcaaaggcgtgttctacaaagcacttcagaattgtccttgggcaaaggcgctgtacctggatgccgtggagcacttccccgaagagatgcaggaggtcctggacctgatgacggagaaggagctccgggtgcgcctgcccctggaggagctggcgcttctgctggaggactagagaccaggagggaatgggccctgccttccaggccttgtcgcctgccccgccagagctgggatgctcgagattggggatgcctggaaaaaacagtgttgtggaacagaaatttgggctagaaagagctggaaaagaaggatgacaagtcagagcccctgaggaaggtggctggccagccagccaagtggacacttaccttgccgggcttggacacatgtgcttggacacagacctgctctgaaaggagagaagggcaagacagacagggaaggggaagctttggtacggttttgagcatcctggagagagatgaggtttcggaacctgagaacaagggatgacctgggtggcgagcggcagacgtcagcctgggcctgtggagattcctagtaggaacactacggctgctttcctgcctgagtgctgagaaacccgcaggctccacagaccttccaatacggaaagatgtttccttccaaagccacaggcacactcttccactgcagagaccactggctctgtgtcacgccctcccattagctgctgtccagctctgccaccggctctgggcatgtgaggcagggccagaggtgctgaaagcccccctactgcccaggtccccctgcttattgctgctgagcgccgggtgtggaggttccggaaacgagtgtgagaaggagcacgctttattggaggcagagcactgcatgggaccaacaggagaaggcggcctggggggcatcctacacgctcaaaaaagtacacaaggaggttctgctagtaagaaagatcaactggaacatgggttcctctgggcaacttccccaacttcttcccttcaaggggtcagaacaaccccgaccacttccttgaaggcagctgtggtctgctagaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]