GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 00:55:31, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       XR_004271746            3185 bp    RNA     linear   PRI 02-FEB-2020
DEFINITION  PREDICTED: Sapajus apella NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X3, misc_RNA.
ACCESSION   XR_004271746
VERSION     XR_004271746.1
DBLINK      BioProject: PRJNA599380
KEYWORDS    RefSeq.
SOURCE      Sapajus apella (Tufted capuchin)
  ORGANISM  Sapajus apella
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Platyrrhini; Cebidae; Cebinae; Sapajus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022436960.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Sapajus apella Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3185
                     /organism="Sapajus apella"
                     /mol_type="transcribed RNA"
                     /isolate="SASKATOON/1434"
                     /db_xref="taxon:9515"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..3185
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 101 ESTs, 1 Protein, and
                     97% coverage of the annotated genomic feature by RNAseq
                     alignments, including 38 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:116557893"
     misc_RNA        1..3185
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:116557893"
ORIGIN      
ccccttggccccgccctgtcctgctttgccctgcctccctgccccgccttgtccccgtgccatgacgcccctcccctctgggccccgcccctcccgcttcggggtcaggccctagaaatcgccgggaaaaccacacttcccagagtgcaccgcgatggcggggtcctcggaccggcgcttgctcgtcggcgccatttctgtagagaggaacggcggtgcggcctgtggtcatggcgctgttcccggcctttgcgggggttagtgaggcccccgatagtgggagctccaggaaagagttagactggctgagcaacccaagcttttgtgttggatccataacgtccctgaaccaacaaactgaagcagccacagcccatatttctgaagggtcaccgctgtcgaggagtcctccgaaatcagagccttcagatgaaagtgacactaacaaaaagttcaaacaaacaagcagaaaaaagaagaaagagaaaaagaaaagaaggaagcatcagcatcataagaaaacaaagaggaaacatggacagtcgagtagcagcaggtctgagacagacactgattctgaaaaggacaaaccttccagagccatcggaggcagtaaaaaggaatctgagaaaccgaatgaaggaaataatgctgcagctgaatctggacatcgctttgtttggcttgaggacattcaggctgtggcaggagaaaccttcagaacagataagaaaccagatcctgcaaactgggagtacaagtctctctaccgaggggatatagcaagatacaagaggaaaggagactcctgccttggcattaatcctgcgaaacaacgcatatcttgggaagggacttccacagagaagaagcattcacgcaagcaggttgaacgctattttactaagaagagtgtggggttaatgaacatcgatggagttgccattagcagtaaaactgaacctccatcatccgaccccgcctcctttataccagtgaaggacttggaagatgcagctcctgttacaacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctgcaaggacagggtcctccagagcaggaatcaaagcagccagacacacagccagacagcgagagtgcggctctcaaggccagggtggaggagtttaacaggagggtgcgggagaatccgcaggatacgcagctgtggatggcatttgttgcttttcaggacgaggtcatgaaaagtcctggcttgtatgccatcgacgaaggagagcaagaaaagcgaaagaggtccctgaagctcgttctggagaagaagctggccattctggagcgggccattgagagcaacctgagcagtgtggatctgaaactggccaagctgaagctctgcgcagagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaataatacagccctttggcagaaataccttttgttttgccagagccagtttagtaccttttcgatatcaaaaattcacagtctttatggaaaatgcttgagtaccttgtctgctgttaaggacggcagcatcttatctcaccctgcgttgcctggcacagaagaggccatgtttgcactctttcttcagcagtgccacttactgcggcaggccggccactctgagaaggccatctcattgttccaggccatggtggacttcaccttcttcaaacctgacagcctgaaagatatgcccaccaaaggacaggtggaattctttgagcccttttgggacagtggagagccccgggctggggagaagggagcccgaggctggaaggcgtggatgcaccagcaggagcgaggtggctgggtggtcatcaacccagatgaggatgacgatgaaccagaagaggacgaccaggaaataaaagataagactctgcccaggtggcagatctggcttgctgctgagcgttcccgagaccagaggcactggcggccctggcgccctgataagaccaagaagcaaaccgaggaagactgtgaggatcctgagagacaggtgttgtttgatgatattgggcagtctttggtcagactttccagcccagatctgcagttccagctggtgcaggcctttctgcagttcctgggtgtgccttccggcttcactcctccagcctcctgtctttatctggccatggatgagaacagcctctttgataatggactttatgatgaaaagcccttgacttttttcaaccctttgttttccggggccagctgtgtgggccgcatggaccggctgggctgtcctcgctggaccagggggcagaaccgagagggcgaggagtttatccgcaatgtcttccacctagtcatgcctttgttttcaggcaaagagaagtctcagctctgcttctcctggttacagtatgagattggaaaggtcatgtggtgtctgcacactaaaaacaagaagagattaaagtcacaagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaacttttgcctctggaagcagtatgcccatctggagtggttgcttggcaacacagaggatgctagaaaagtttttgacacagcactcggcacggcaggaagccaaggactgaaggactctgaactctgtgagctcagtctgctctatgccgagctggaggtggagctggaggtggagctgttgccagaagtgagaggggccgcctccgcccgagctgttcacatattaaccaagctgaccgagagcagcccctacgggccctacactggacaggtgttggctgttcacattttgaaagcacgaaaggcttacgagcacgcgctacaggactgtttgggtgacagctgtgtctccgatccagctcccaccgattcctgtacccgcctaattagcttggccaaatgcttcatgctcttccagtatttgaccatcggaattggtgctgctgtggggatatacgaacaggttagatggtagagagatccacgccacgattcctgagaccggcttaacgcatcggatccaagccctgtttgaaaatgccatgcgcagtgacagtggcagccagtgccccttgctgtggaggatgtatttgaactttttggtttccttaggaaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]