GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:29:47, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XR_004256849            4800 bp    RNA     linear   VRT 31-JAN-2020
DEFINITION  PREDICTED: Thamnophis elegans testis and ovary specific PAZ domain
            containing 1 (TOPAZ1), transcript variant X6, misc_RNA.
ACCESSION   XR_004256849
VERSION     XR_004256849.1
DBLINK      BioProject: PRJNA602516
KEYWORDS    RefSeq.
SOURCE      Thamnophis elegans (Western terrestrial garter snake)
  ORGANISM  Thamnophis elegans
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Colubroidea; Colubridae; Natricinae;
            Thamnophis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045558.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Thamnophis elegans Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4800
                     /organism="Thamnophis elegans"
                     /mol_type="transcribed RNA"
                     /isolate="rThaEle1"
                     /db_xref="taxon:35005"
                     /chromosome="Z"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="juvenile"
                     /country="USA: Born in Anne Bronikowsk lab at ISU; MOM,
                     2012; Eagle Lake; PAP"
                     /lat_lon="42.02482 N 93.64411 W"
                     /collection_date="01-Apr-2018"
                     /collected_by="Anne Bronikowski"
     gene            1..4800
                     /gene="TOPAZ1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 6 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116520837"
     misc_RNA        1..4800
                     /gene="TOPAZ1"
                     /product="testis and ovary specific PAZ domain containing
                     1, transcript variant X6"
                     /db_xref="GeneID:116520837"
ORIGIN      
gagcaagcgcaccaacgcagatgtggaggtggcggcggcagctttgggtggcccggaaagagagcgtttaattaaggcaacctggtttggtttttaatgcgataattgagtttggggggtgggggtagaaggaaattatctatgattcctatggttagggggtcttctcaatacagctttttgcattgttcgctttacagtaattcgaataatgttccttcggatttattgccgacgcgatgtgcaaaagttgcgaactggggaatctgcgtaggcggtagacaagtgccgtctccgctttcttctggagaagagtctacgcaaactcggctacttttcagcatctggacagacatcctcccgttggcttaaagccttcagtatctcaaaaattaagacgatagaagcaggctctggtttttgaagacaacatatttatctcgttttctcctaattaacctttcagttataacatctccgaagaagaaactttgggttaatgtatagtgcctttacttgaatggctttcttaacactgtctttaaatgcttagttcttcttttacaaaaacgaactaaaacaattaagattgagcttgtttggtaacaaaaccactagcaattcttatattgtaattatgttgaccaaagaagaatttatgtctagttttggtgagccatagttgaatgtgagtttctcagaagctcacaattggcttcctgaaaagctcatttgtttctaagcttttaccagcacattttgcctattctgttgcctaaaattaatttgcaaacattagaaaattaatccgtagtgcatttaattttgtttgttactagaagttggaatggaaacccaaattggacagacaacatctgtgataaaaaactctaaaaaaaatgagagtggggacagtgaccaattgttctctttgccatttccagtgaaatctcataacttaagtaagcaatacattcctacttctgaaacagtcataaaagataaggatcagcagaacaggaattttgtctctgaggaaagagagaagagaagttgccataatacagacatcatgccagtcagctgtgactacattttaaacattaaattggaagataaggttttgataaaaggaagagagtcacagaacagagtatcaagtgtgatgaaaagggaacatgatgttgctttgcaaaatacattgcaatcagagagtaggaaaaaaaggcgtaagagttcttcattggaagtgggatctcaaggagacattgtcatagaaaaaatatatactagttctttactagaacatgaagaaaaaacccaaagttccacaaaaaatgcaaagaatttaaagaaaaattctttgataatgagaagattacacgagatgggaactgtaactgaaaaggatgggacttcagtaataattaatttaggctctgaaaatgtatcaggaaacctgcagaaaagccacagtcacttagcctcagaatcaaaacttcagcataaaagatggaattttaggaagcgaattaaaccaatttggccaaagcagaatagaattcaaaaagtaaagagaaacataactgagaagcatggtaattcagtaatgatagatttagggactgaaaaagcaccagaaaacctgcagaaaagctgtagctgcgtagtctcacaattgagtcttcagcagaaaacatggaattttagggagaggattaaaccagcttggccagatcaaaagcagcacaaaagtcagagaataaagagaagtatatgtaagttagattgtatcatacagaacataagtgtattaaaatatagagaaaatttcccaaaatcgcagatatatgtaaagtacccaattagtgtgagctcagctgctgtgacacatttttcaagtaactgtatagaaggaatagagtgtctaatgaaaaacgcaatggtgaattttgtaaaacaaaaagaactgactgtctcaaaattgcaaaagaatataaaagtttcaaatggacttaggcaagatttattggattctatagtagactttgaagaaaatagatgcaaaagtaatgtaaaagaaggaataaataggatggtaacacaaatgttttcaaaatcaaaaatctatacaagtgatggtgaaaaacaaagttggaaatcagaaagaagtgttgcagagattgtggaatacagccaatggattttaaagaagaaagtaactaaagaacaaatggattgtttacctaaagagaatctgttggttaccaaaacagagggaactagtaaggaagagacaaatggaaaggatgaaattgtttcttcaactgatcttaaaaaagaaatcaaaacatttagagaagatacccttgacattttaagtagacaatatggaaggctgccatatacaattctgaatatattaaagaactgcaacatagagacagcattagaacagtctgcatgtctactgataactgaggcaaatgtgcccaagaacaacaattctgttaaactttgcttttggaagcagactaagaaatattgtaacactactttttctatcacaaatactgcatgtctagaaaattttgacatacgaatacttgaaaagaaaattgaaaaaagcgcattggtgaagtatcggaatgaaagatttgaatggctttctatgtataatgttcctccctgcaaaaagagtctagtagtaaaatcatttgattgttattacattaagacattacaacctacaggtattgaggctcaaagctatataattaattgtagatctctgcatactgcgtttgatcaaggaaaatccctaacttctaagggtatgggacagaatgaacttagtagtatccctaatgtaatacataatataaaattaatcacacaaaaagacattttggtttcaagagaaatgtcccagcatactaaaagtcaaaatgcaaagcgaatcaaggaaaataaattgtctatggattttaaaaagccatgcaaaaaactaaaaatgccagaggacttagaagaatcatcggtcatgaaagttctcataaatgaagatatttctgctgaacatgacataccaatagaagaaaatactgttgccatagattctgcagtaatttcagaaaaactagattataatgaaacaagtatcttttctttacttgattgtatacctgattttagtctagagctgccttctcaaaatcaagttgccaccatgtctagcaatgaaacagcagaccaagagcacttcattgcatacggttacagtatttttgagaaaccagtagttctcaaaacagacaagaatgaatcaaaagaaatagagccatttattgacttcagtaaaatggatgaaaataaatccatagcggagacagtggatattgaaaaaaatatggtctgtaatagtaatgctactccctacatgaaaagaaaaaggacatgtaacataaaaacaaaaaaaactggtaggaaaccgtgtctgtatagctgtcaaagggcaatcccaattagtggtaaaaatacatggcctcgtgaatcatgcgcaaggacatccttgtcgatttgtaaaaatcatgcattggattcacatagaggatatttagaagatactgattcagtaacaaaatggagcaaattggaggtccataaaccattggtagatagttgtaaaatatctctaaatacaatggaatgtgctgttgaaagtccattttcagactgcatattgcatatgggcaagatattttcaccaattactgagaataggttttcttatgatgatatggaaagatctaaacaaagtactgaaattgtagaatcaaaagtggttttgaatttattaaaagaaaaaggaaaaagtataaatattcagaatgactcatttgcaagcattaggaaaaataggacagataatccatcagttaccaaacaaaaaactgtgttgaaaaatttgacatcaggaactttgtcaaatttcaaaattcctttacttgaaggtaaaggtaattttagaaaattagaaactgaaacatcatccgaaaaggatactggcaattcttcaaatattttagagaatgttctttctccaaaagaagctagaattaaaatggcttcatctgacaaaaaatttagctcacaaatccaatcagaacaggagaattatacgtctgcactggaaaaatacatgcatcaattcaacagtgatatttctgaaaatgtttctaaaaagagaagaatttgtaatacttttgagaatacttcacataagaataaactaaaatcaccaactttgaatgatactcctttctctttgaatactggaaatatagaggaacaaatgctaaattctgctttggcctcagaaattattgataaagttaatgtcaacaataagttggcgcaggagagcgatgacatttgtccagatattcttaaggcttatgaagatgatattcttgtaattgatgttattcaagatgatccggacctgtttggagataatgttaagcaagaagatgacactgcaaagattaataatactaaaaacatttatagcagtcacttttcagaaaaagatctggaatggaaatcggagtcttctcaattttcaaaaagcaagcatttgaaattcattagagaaagccgctttcaagattatgaaacactgaaattggatgataatgctgatggtttggtgatacaagtatgaattttcaaagaaattgcttgctatgcaagaacagaaaacaaatgttcaagactttgcaaaaattgagaataccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]