GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:28:55, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_004244600            4231 bp    RNA     linear   PRI 13-MAR-2020
DEFINITION  PREDICTED: Hylobates moloch NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X4, misc_RNA.
ACCESSION   XR_004244600
VERSION     XR_004244600.1
DBLINK      BioProject: PRJNA600985
KEYWORDS    RefSeq.
SOURCE      Hylobates moloch (silvery gibbon)
  ORGANISM  Hylobates moloch
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hylobatidae; Hylobates.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022611658.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Hylobates moloch Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4231
                     /organism="Hylobates moloch"
                     /mol_type="transcribed RNA"
                     /isolate="HMO894"
                     /isolation_source="EBV transformed lymphoblastoid cell
                     line"
                     /db_xref="taxon:81572"
                     /chromosome="Unknown"
                     /sex="male"
                     /note="Lionel"
     gene            1..4231
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 107 ESTs, 6 Proteins, and
                     96% coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:116456294"
     misc_RNA        1..4231
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X4"
                     /db_xref="GeneID:116456294"
ORIGIN      
gctttgccctgcctctccctgccccgccgcgcccccggtcccttgacgactctcctctctgggccccgcccctcccgcttcggggtcaagccccagagagcgccgcgaaaaccacatttcccagagtgcaccgcgacggcaggggtcctcagacaggcgctcgctcgccggcgccatctctataaagaagaacggcggtgcggcctgtggtcatggcgctattcccagcgtttgcggggcttagtgaggctcccgatggcgggagctccaggaaagagttagactggctgagcaacccaagcttttgtgttggatccataacgtccctgagccaacaaactgaagcagccccagcccatgtttctgaagggccaccgctgacgaggagtcacctgaaatcagagtcttcagatgaaagtgacactaacaaaaagctcaaacaaacaagcagaaaaaagaagaaagagaaaaagaaaaaaaagaagcatcagcatcataagaaaacaaagaggaagcatgggccatcgagtagcagcaggtctgagacagacaccgattctgaaaaggacaaaccttccagaggcgtcggaggcagtaaaaaggaatctgagaaaccgaatcaaggaaataatgctgcagctgatactggacatcgctttgtttggcttgaggacattcaggctgtgacgggagaaaccttcagaacagataagaaaccagatcctgcgaactgggagtacaagtctctctaccgaggggatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcttgggaagggacttccacagagaagaagcattcacgcaagcaggttgaacgctattttactaagaagagtgtgggattaatgaacattgatggagttgccattagcagtaaaactgaacctcccttatctgagcccatctcctttataccagtgaaggacttggaagatgcggcttctgttacaacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacagggtcctccagagcaggaatcaaagcagccagacgcacagccagacagcgagagtgcggctctcaaggccaaggtggaggagtttaacaggagggtgcgggagaatcctcgggatacgcagctgtggatggcattcgttgcttttcaggacgaggtcatgaaaagtcctggcctgtatgccatcgaggaaggagagcaggaaaagcgaaagaggtccctgaagctcattctggagaagaagctggccattctggagcgggccattgagagcaaccagagcagtgtggatctgaaactggccaagctgaagctctgcacagagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttgcatcccaataatacagccctttggcagaaataccttttattttgccagagccagtttagtaccttttcgatatcaaaaattcacagcctttatggaaaatgcttgagcactttgtctgctgttaaggatggcagcatcttatctcaccctgcgttgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccactttctgcggcaggctggccactctgagaaggccgtctcattgttccaggccatggtggacttcaccttcttcaaacccgacagcgtgaaagatctgcctaccaaaggacaggtggaattctttgagcccttttgggacagtggagagccccgggctggggagaagggagcccgaggctggaaggcgtggatgcaccagcaggaacgaggtggctgggtggtcatcaacccagatgaggatgacgatgaaccagaagaggacgaccaggaaataaaagataagactctgcccaggtggcagatctggcttgctgctgagcgttcccgagatcagaggcactggcggccctggcgccctgataagaccaagaagcaaactgaggaagactgtgaggatcccgagagacaggtgttgtttgatgatattgggcagtctttgatcagactttccagccacgatcttcagttccagctggtggaggccttcctgcagttcttgggtgtgccttctggctttactcctccagcttcctgtctttatctggccatggatgagaacagcatctttgataatgaactttatgatgaaaagcccttgacttttttcaacccttcgttttctggggctagctgtgttggtcgcttggataggttaggctgtcctcgctggaccaggagtcagaaccgagagggcgaggagttcatccgcaatgtcttccaccttgtcatgcccttgttttcaggcaaagagaagtcccagctctgcttctcctggttacagtatgagattgcaaaggtcatttggtgcctgcacactaaaaacaagaagagattaaagtcacaagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaactgcaacaacttttgcctgtggaagcagtatgcacatctggagtggttgcttggcaacacagaggatgccagaaaagtttttgacacagcactcggcatggcaggaagcagagaactgaaagactctgacctctgtgagctcagtctgctctatgctgagctggaggtggagctgtcgccagaagtgagaggggctgccacagcccgagctgttcacatattaaccaagctgactgagagcagcccctatgggccctacactggacaggtgttggctgttcacattttgaaagcgcgaaaggcttacgagcacgcgctgcaggactgtttgggtgacagctgtgtctctgatccagctcccaccgattcctgtagccgcctaattagcctggctaaatgcttcatgctcttccagtatttgaccatagggattgatgctgctgtgcggatatacgaacaggtgtttgcaaaactgaacagttctgttttcccagaaggctctggcgaggggtacagtgccagctcccagagttggaccagtgttctcgaagccatcacactgatgcacacgagcctgctgagattccacatgaaagtgagtgtttacccactggcccctctgcgagaggcactctcacaggctttaaagttgtatccgggcaaccaggttctttggaggtcctatgtacagattcagaataagtcccacagtgccagcaagaccaggagattttttgacacaatcacgaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaactgaggaagagactggtggaaactgtccagaggttagacggtagagagatccatgccacaattcctgagaccggcttaatgcatcggatccaagccctgtttgaaaatgccctgtgcagcgacagtggcagccagtgccccttgctgtggaggatgtatttgaactttctggtttccttgggaaataaagaaagaagcaaaggtatattctacaaagcacttcagaattgtccttgggcaaaggtgttgtacctggatgctgtggagtacttccccgatgagatgcaggagatcctggacctgatgactgagaaggagctccgggtgcgcctgccgctggaggagctagagctgctgctggaggattagagagcagcgggggaatgggctgtgcctgcgaggccaagttgcccaccctgcggagctaggaggcgcgagcggagaacggaaacaaccctcaacttgaggaagttgagagctcgactccaaggtggacttgctccccctccccgagagctgactggcttgaactgtcatgagttcctggctgcccacaatgagggaccttctccacccttgtcctctgcgcggggcggacatcagccagatacatcacagacctgattgggggcagggagtaaggaagtccaggaccaaaccatgctccccatgacggcagctggcgcctcagtccccatctgactcatgtttcttctcatctggttcagaacttagaagggcgtggcctctgatcagctggtcccctcaaaccccagtggcaacctgtcccttgagagccaggaatggctcttagcagtgggcagtgagcccccgagaggataaagcggctgctcgaacagattgcgagcacattacttgctgcatgggaagag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]