GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 01:06:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_004142555             841 bp    RNA     linear   MAM 23-OCT-2019
DEFINITION  PREDICTED: Camelus dromedarius uncharacterized LOC116158284
            (LOC116158284), ncRNA.
ACCESSION   XR_004142555
VERSION     XR_004142555.1
DBLINK      BioProject: PRJNA565028
KEYWORDS    RefSeq.
SOURCE      Camelus dromedarius (Arabian camel)
  ORGANISM  Camelus dromedarius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Camelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044527.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camelus dromedarius Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..841
                     /organism="Camelus dromedarius"
                     /mol_type="transcribed RNA"
                     /isolate="Drom800"
                     /isolation_source="isolated from an animal called Varis"
                     /db_xref="taxon:9838"
                     /chromosome="17"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="Austria: Eithental"
                     /collection_date="13-Jan-2013"
                     /collected_by="Pamela Burger"
                     /breed="African"
     gene            1..841
                     /gene="LOC116158284"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:116158284"
     ncRNA           1..841
                     /ncRNA_class="lncRNA"
                     /gene="LOC116158284"
                     /product="uncharacterized LOC116158284"
                     /db_xref="GeneID:116158284"
ORIGIN      
ttggatagagcaatggttgtggagtttcttaaaaaggcagcctcagggacctatgcccagaggctgtgttttactaggcataaggtagaggccagggatctgtgtttaaacaaataatgcaagagattctaaggtgtgtggtcttgagagtacatggcaaaatatctgaaaggctattggaacattccagtcaaggatcagaaggcaacacttagagctgccacttacatgcctctctcagtttactttggctcaaatatccaaagggttaaaaaagaatctttactttgctgggttcttctaaggaataaacaagttaatattataccattgttcaccaccttcaacatcaacaccaataacaaaggaaaaacacttcagtgtgttcacacgtgctgggtgctggtttcagtgtttacacacattaactcatttaatcctcaacgtgtggacatatgttcagagggactaactgagttatgttcaagactgagcatataactactttcctatgattaaaattagcatcaggaaaaccacatcacaaacaaaagtcctaataaaagtcgctgactaggactatcctcgtgtgtctgtgtgtgtgtgtgtgtacacatgaaagagatgtatttgctcagggtctatcaatcttgttctgcctgttttctcaagtcagcagccttatctttacatttactccactcaatctcttcttgtcattttccctttctgtctgaaaataactacccccaagtctgcaaagcatcatctttgtattccatttcttgttgtaaagagtttgtgacattctgcgagatggacatgctagatcggaagagca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]