2024-04-26 01:06:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004142555 841 bp RNA linear MAM 23-OCT-2019 DEFINITION PREDICTED: Camelus dromedarius uncharacterized LOC116158284 (LOC116158284), ncRNA. ACCESSION XR_004142555 VERSION XR_004142555.1 DBLINK BioProject: PRJNA565028 KEYWORDS RefSeq. SOURCE Camelus dromedarius (Arabian camel) ORGANISM Camelus dromedarius Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda; Camelidae; Camelus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044527.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Camelus dromedarius Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..841 /organism="Camelus dromedarius" /mol_type="transcribed RNA" /isolate="Drom800" /isolation_source="isolated from an animal called Varis" /db_xref="taxon:9838" /chromosome="17" /sex="female" /tissue_type="blood" /dev_stage="adult" /country="Austria: Eithental" /collection_date="13-Jan-2013" /collected_by="Pamela Burger" /breed="African" gene 1..841 /gene="LOC116158284" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:116158284" ncRNA 1..841 /ncRNA_class="lncRNA" /gene="LOC116158284" /product="uncharacterized LOC116158284" /db_xref="GeneID:116158284" ORIGIN
ttggatagagcaatggttgtggagtttcttaaaaaggcagcctcagggacctatgcccagaggctgtgttttactaggcataaggtagaggccagggatctgtgtttaaacaaataatgcaagagattctaaggtgtgtggtcttgagagtacatggcaaaatatctgaaaggctattggaacattccagtcaaggatcagaaggcaacacttagagctgccacttacatgcctctctcagtttactttggctcaaatatccaaagggttaaaaaagaatctttactttgctgggttcttctaaggaataaacaagttaatattataccattgttcaccaccttcaacatcaacaccaataacaaaggaaaaacacttcagtgtgttcacacgtgctgggtgctggtttcagtgtttacacacattaactcatttaatcctcaacgtgtggacatatgttcagagggactaactgagttatgttcaagactgagcatataactactttcctatgattaaaattagcatcaggaaaaccacatcacaaacaaaagtcctaataaaagtcgctgactaggactatcctcgtgtgtctgtgtgtgtgtgtgtgtacacatgaaagagatgtatttgctcagggtctatcaatcttgttctgcctgttttctcaagtcagcagccttatctttacatttactccactcaatctcttcttgtcattttccctttctgtctgaaaataactacccccaagtctgcaaagcatcatctttgtattccatttcttgttgtaaagagtttgtgacattctgcgagatggacatgctagatcggaagagca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]