GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-26 09:33:36, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_004028070            4517 bp    RNA     linear   PRI 17-SEP-2019
DEFINITION  PREDICTED: Nomascus leucogenys NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X3,
            misc_RNA.
ACCESSION   XR_004028070
VERSION     XR_004028070.1
DBLINK      BioProject: PRJNA564096
KEYWORDS    RefSeq.
SOURCE      Nomascus leucogenys (northern white-cheeked gibbon)
  ORGANISM  Nomascus leucogenys
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hylobatidae; Nomascus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044402.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nomascus leucogenys Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4517
                     /organism="Nomascus leucogenys"
                     /mol_type="transcribed RNA"
                     /isolate="Asia"
                     /bio_material="CORIELL:NLL605"
                     /db_xref="taxon:61853"
                     /chromosome="22a"
                     /sex="female"
                     /tissue_type="EB transformed lymphoblast cell line"
                     /dev_stage="adult"
     gene            1..4517
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, 100 ESTs, 6 Proteins, and
                     98% coverage of the annotated genomic feature by RNAseq
                     alignments, including 3 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:100595022"
     misc_RNA        1..4517
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:100595022"
ORIGIN      
gctttgccctgcctctccctgccccgccgcgcccccggtccgttgacgactctcctctctgggccccgcccctcccgcttcggggtcaagacccagagagcgccgcgaaaaccacatttcccagagtgcaccgcgacggcaggggtcctcagaccggcgctcgctcgccggcgtcatctctataaagaagaacggcggtgcggcctgtggtcatggcgctgttcccagcctttgcggggcttagtgaggctcccgatggtgggagctccaggaaagagttagactggctgagcaacccaagcttttgtgttggatccataacgtccctgagccaacaaactgaagcagccccagcccatgtttctgaagggccaccgctgacgaggagtcatctgaaatcagagtcttcagatgaaagtgacactaacaaaaagctcaaacaaacaagcagaaaaaagaagaaagagaaaaagaaaaaaaggaagcatcagcatcataagaaaacaaagaggaagcatgggctgtcgagtagcagcaggtctgagacagacactgattctgaaaaggacaaaccttccagaggcgtcggaggcagtaaaaaggaatctgagaaaccgaatcaaggaaataatgctgcagctgatactggacatcgctttgtttggcttgaggacattcaggctgtgacgggagaaaccttcagaacagataagaaaccagatcctgcgaactgggagtacaagtctctctaccgaggggatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcttgggaagggacttccacagagaagaagcattcacgcaagcaggttgaacgctattttactaagaagagtgtgggattaatgaacattgatggagttgccattagcagtaaaactgaacctcccttatctgagcccgtctcctttataccagtgaaggacttggaagatgcggctcctgttacaacctggttgaatcctctggggatttatgatcagtcaaccacacagtggctacaaggacagggtcctccagagcaggaatcaaagcagccagacgcacagccagacagcgagagtgcggctctcaaggccaaggtggaggagtttaacaggagagtgcgggagaatcctcgggatacgcagctgtggatggcattcgttgcttttcaggacgaggtcatgaaaagtcctggcctgtatgccatcgaggaaggagagcaggaaaagcgaaagaggtccctgaaggtcattctggagaagaagctggccattctggagcgggccattgagagcaaccagagcagtgtggatctgaaactggccaagctgaagctctgcacagagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttgcatcccaataatacagccctttggcagaaataccttttattttgccagagccagtttagtaccttttcgatatcaaaaattcacagcctttatggaaaatgcttgagcactttgtctgctgttaaggacggcagcatcttatctcaccctgcgttgcctggcacggaagaggccatgtttgcactctttcttcagcagtgccactttctgcggcaggccggccactctgagaaggccatctcattgttccaggccatggtggacttcaccttcttcaaacccgacagcgtgaaagatctgcctaccaaaggacaggtggaattctttgagcccttttgggacagtggagagccccgggctggggagaagggagcccgaggctggaaggcgtggatgcaccagcaggaacgaggtggctgggtggtcatcaacccagatgaggatgacgatgaaccagaagaggacgaccaggaaataaaagataagactctgcccaggtggcagatctggcttgctgctgagcgttcccgagatcagaggcactggcggccctggcgccctgataagaccaagaagcaaagtgaggaagactgtgaggatcccgagagacaggtgttgtttgatgatattgggcagtctttgatcagactttccagccacgatcttcagttccagctggtggaggccttcctgcagttcttgggtgtgccttctggctttactcctccagcctcctgtctttatctggccatggatgagaacagcatctttgataatgaactttatgatgaaaagcccttgacttttttcaacccttcattttctggggctagctgtgttggtcgcttggataggttaggctgtcctcgctggaccaggggtcagaaccgagagggcgaggagttcatccgcaatgtcttccaccttgtcatgcccttgttttcaggcaaagagaagtcccagctctgcttctcctggttacagtatgagattgcaaaggtcatttggtgcctgcacactaaaaacaagaagagattaaagtcacaagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaactgcaacaacttttgcctgtggaagcagtatgcacatctggagtggttgcttggcaacacggaggatgccagaaaagtttttgacacagcactcggcatggcaggaagcagagaactgaaagactctgacctctgtgagctcagtctgctctatgctgagctggaggtggagctgtcgccagaagtgagaggggccgccacagcccgagctgttcacatattaaccaagctgactgagagcagcccctatgggccctacactggacaggtgttggctgttcacattttgaaagcgcgaaaggcttacgagcacgcgctgcaggactgtttgggtgacagctgtgtctctgatccagctcccaccgattcctgtagccgcctaattagcctggctaaatgcttcatgctcttccagtatttgaccatagggattgatgctgctgtgcggatatacgaacaggtgtttgcaaaactgaacagttctgttttcccagaaggctctggcgagggggacagtgccagctcccagagttggaccagtgttctcgaagccatcacactgatgcacacaagcctgctgagattccacatgaaagtgagtgtttacccactggcccctctgcgagaggcactctcacaggctttaaagttgtatccgggcaaccaggttctttggaggtcctatgtacagattcagaataagtcccacagtgccagcaagaccaggagattttttgacacaatcaccaggtctgccaaacccttggagccttggttgtttgcaattgaagctgagaaactgaggaagagactggtggaaactgtccagaggttagacagtagagagatccatgccacaattcctgagaccggcttaatgcatcggatccaagccctgtttgaaaatgccctgtgcagcgacagtggcagccagtgccccttgctgtggaggatgtatttgaactttctggtttccttaggaaataaagaaagaagcaaaggtgtattctacaaagcacttcagaattgtccttgggcaaaggtgttgtacctggatgctgtggagtacttccccgatgagatgcaggagatcctggacctgatgactgagaaggagctccgggtgcgcctgccgctggaggagctggagctgctgctggaggattagagagcagcagggaaatgggctgtgcctgcgaggccaagttacccaccctgcggagctaggaggcgcgagcggagaacggaattgctgtatacttgtatctcctccgcaccacgtttagaaaagccagtgtgtaattttggctggtaactgatggacacggcgggcagcggcgggcagcagcaggcagggcagcgcacgagagcgcctcccagggcacggtgggaaactggccagcctagccccgctactgccctctcctgctcatccccagtccctgagctacaggtggctgtaggcagaagcccactgggtgttccttagcgacagacaggtcgtcacctgctccccttgatgccttttcacagaaacaaccctcaacttgaggaagttgagagctcgactccaaggtggacttgctccccctccccgagagctgactggcttgaactgtcatgagttcctggctgcccacaaagagggaccttctccacccttgtcctctgcgcggggcggacatcagccagatacatcacagacctgattgggggcagggagtaaggaagtccaggaccaaaccatgctccccatgacagcagctggtgcctcagtccccatctgactcatgtttcttctcatctggttcagaacttagaagggcgtggcctctgatcagctggttccctcaaaccccagtggcaacctgtcccttgagagccaggaatggctcttagcagtgggcagtgagccctcgagaggataaagcggctgctcgaacagattgcgagcacattacttgctgcatgggaagag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]