GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 01:08:34, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_003969663            8420 bp    RNA     linear   MAM 27-FEB-2020
DEFINITION  PREDICTED: Lynx canadensis NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X5, misc_RNA.
ACCESSION   XR_003969663
VERSION     XR_003969663.2
DBLINK      BioProject: PRJNA558991
KEYWORDS    RefSeq.
SOURCE      Lynx canadensis (Canada lynx)
  ORGANISM  Lynx canadensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Lynx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044308.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Feb 27, 2020 this sequence version replaced XR_003969663.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Lynx canadensis Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..8420
                     /organism="Lynx canadensis"
                     /mol_type="transcribed RNA"
                     /isolate="LIC74"
                     /db_xref="taxon:61383"
                     /chromosome="B3"
                     /sex="male"
                     /tissue_type="muscle, distal limb"
                     /country="USA: Aroostook County, Maine"
                     /lat_lon="42.2466 N 71.6746 W"
                     /collection_date="2017-12-05"
                     /collected_by="Tanya Lama"
     gene            1..8420
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 18 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:115516777"
     misc_RNA        1..8420
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X5"
                     /db_xref="GeneID:115516777"
ORIGIN      
gtgcgagtgggaaaaaccacacttcccagagtgcaccgcaaccgcgaaggcctcactaccggcgtccgctcgccggcgccatttctggagagggggacggcggtgcggcctgccgtcatggcgctgttcccggcctttgcaggcattggtgaggcttccggtagcggcagcgccaggaaagaattagactggctgagcaacccaagcttttgtgctggagccataacctctctgagccaacaaactgaaggggccacagccctggtttctgaagggtcacctctgacaaggagccctctgaaatcagagccttcggatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcaccacaagaaaaccaggagaaaacatgggcggtccagtagcagtgggtctgagccagatagtgattctgaaaaggataaagcttccagaagcattagagacagtaaaaaggaatccgagaaaccaaaatacaagaggaaaggagactcctgccttggcattaaccccaagaagcagtgcatatcctgggagggggctgccacagaaaagaagcactcacacaagcatgtcgagcgctatttcacgaagaagagcgtgggactgatgaacattgacggagtcgccgttggcggtaaaaccgaacctccctcatctgagccggtctcatttatcccagtgaagggctcggatgatgtggttcctcctgttacgacctggttgaaccctctggggatttacgatcagtccaccacgcagtggttacaaggacagggtccttcagagcaagaatcaaagcagccagactcacagacagacagagagcatgccctgctcaaggccaaagtggaggagtttaacaggagagttcgggagaatccccgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaagagccctggcctgtatgccatcgaggaaggagagcaggaaaagcggaagcggtctctgaggctcgttctggagaagaagctggccatcctggagcgggccatcgaaagcaaccagagcagcgtggacctgaaactcgccaagctgaagctctgctccgagttctgggagccctccgccctggccaaagagtggcagaaactgatctttctgcatcccaacgatacagccctgtggcagaaataccttttattttgccagagccagtttagcacctttacggtgtcaaaaattcacggtctgtacggcaagtgcttgagcaccttgtctgctgtgaaggacggcagcatcttatcgcaccccgccctgccgggcaccgaggacgccatgtttgctctctttcttcagcaatgccacttcctgcggcaggctggtcactctgagaaggcggtctctctgttccaggccatggtcgacttcaccttcttcaaacccgacagtgtgaaagacctgcccaccaaaggacaggtggaattctttgagcccttctgggacagtggggagccccgggttggcgagaagggcgcccgaggctggagagcgtggatgcaccagcaggagcggggcggctgggtggtcatcagtccagatgatgatgacgatgagccagaagatgaggaccaggaaataagagagaagagtctgcccaggtggcagatctggcttgccaccgagcggtcccgagaccagaggcactggcggccgtggcgccctgataagaccaagaagcaaaccgaggaagactgtgaggatccagagagacaggtgctgtttgatgacattgcccagtctatgatccgtctttccagccaggatcttcagtttcagctggttgcggcctttctgcagttcctgggcgtgccttctggcctcagccctccagcctcctgcctctacctggccatggatgagaacagcatcttcgatgacgggcttcatgacgaaatgccactgactttcctcaacctttccttttccggtgtcagctgtgttggctgctcagacccactgggccgccggcgctggacccggggtcacaatcgagagggcgaggagttcatccgcaacatctttcaccttgtgatgcctttgttttcaggccgggagaggtctcagctctgcttctcttggttacggtacgagatcgagaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacagggaaagaactgcaagaaactagccaaaaatctcctgaaggagccagaaaaccgcaacaatttttgcctctggaagcagtacgcacatctggagtggctgctcggcaacaccgaggacgccaggaaggtgttcgatgcggcgctcagcatggcggggggcagagacctgagggaccgtgagctgtgtgagctcggcctcctctacgccgggctggaggcggagctgttgccggacccgagaggggccgccgcggcgcgagccgttcacgtactgaccaggctgacggagcaggggccctgcgggccctactccgggcaggcgctggccgttcacatcttgaaagctcggaaggcgtacgaacacgcgctgcaggactgtttgggcgacggctgtgtgtccgctccggctcccagcgactccttcgaccgcctgactagcctggtgaaatgcttcatgctctttcagtacttgaccgtagggatcgacgcggccgtgcgggtgtacgagcaggtgctcgcaaaactgaagggctctgttcccccagggggctctggcccggaggacggtgcccgcgcccagggcccccacggcgcgctggaggccgtgacgctgatgcacacgagcctgctcaggttccacacgaaagtcagcctttaccccctggctcctctgcgacaggctctctccgaggcgttaaggttgtacccaggcaaccaggtgctttggcgggcatacgtgcagattcagagcaggtcccacacagccagtgagaccagaagatttttcgacgcggtcaccaggtctaccaaactcttggagccttggttgtttgcgatcgaggccgagaaaatgaggaagagactggtggaaagtgttcacagggtagatggtagagaggtccacgccacaattcccgagaccggcttgacacatcgcatcagagccctgtttgaaaatgcgttgcggagcgacaacggcagccagtgccccttactgtggaggatgtacctgaattttttggtttccttaggaaacaaagaaaggagcaaaggcgtgttctacaaagcacttcagaattgtccctgggcgaaggtgctgtacctggacgccgtggagcacttccccgaagagatgcaagaggtcctggacctgatgacggagaaggagctccgggtgcgcctgcccgtcgaggagctggcgcttctgctggaggactagaccaggagggaacgggccctgccttccgggcctctcgcctgccccgcccccgaccccccccaccggagccgggatgcgcaggacggggatgcgtgtgtgtgagcatgtgtcacgagacctccacttttcaagtttcttaattcttagtaatttgggtctgggttatcagtcttttacctcttgcacattgtttggatgtgtgaaggacacaaaaccattgtttacatattgtatatgtgaatgtgtgtacgtagggaataatcctgccaagtgaaaactaaacccgtcgtggctggtgtgcgggaggtctgttccactcctctgcctggccgtgaacgttccccactggcacccttggtggtcctgccgtcgtggtaggaaaggtctggtttctgagcactcggacctctccccgcagctggtgaggagagcagcttttgcccttaagagccgtttaaaacttggtgttctggcctcgctcccattttaaaagtttctcattatttgctaggctcttgatgccacctcccttctgtggaccaggagcatcacctgggggcttgttagagatgcagcctctgggcccacctcagcccttctgagtcagggcctgcacttgaacaggaccccctggggactcaggtgcaccaagtgtggggggcactgcccaaaggacccctgcggcaggggagtgtgcaggcggccatctgagaagtgcagagtggagccagcgccttcccaccaaacccacccctgcctgggggctgtgacacagaggcccagacccagacctgccaggccacattcttgttttgatttctgagggtatgaatggaacgaaacgtaaatatccacattcagaccactttcttccgaaaaggacacgccttgcagtcattattcaggacactgaactgggaggaaattgctctatcttccctgaggtcctgctctaagagaaacgcggacagctgctgcctctatcctgatctctagaagggctgaagttgtatttctttggcatctcatccagagaagcccgtgtcgtggaagagaatcttgcctagaaaccagcggacactggtgggggagaagggcggtgggtcagggcacccgaggaaggtggctggccagccaagtggacgcttgcctcgatctgccccgcttccttcgcggcttcaagactgaactgttcaagagaggggagaagtgccggaaatggatgaagaaagggagccacgttcccgggccacagatgccgttacacctggaaacttcgcggcaacagaacacacgtccagttcacctacctacactgaggagagagcttgcgttctggctaaatggaaatctccccatttactgcatttattgtctcgcaacacttgccaaaagtaaaacaacccacacaacatgatgtgataaaaccacaatctcagcactaagtttctatctggttgtgaccctcaggatatttcaaatggttcagcaaaaaagaaagtgaacagaatgataaagcaaagaggtaaaacggtaacacttggtgaactgaggtgatgggtatgtgggcatttactattgttgcaacttttctgaagacttcaaatttcccaaaatacaaagttggtgcaaaatttaaaaactctctttaaattgaagttaccgacaaagacactaacctagttctacagatgccaacgatacgcagttcagtgcaggcaccggcgtgaaaaggccccacacacgccgtccctacctgaccatggcacttacccctacctgaaacccaggtcctcacatacaaagcaggctggccccacactcagtgctgccgagcctcgccctaattctggtcatcagggaagaaacgtcctcacgcgcacacacaaccaagaggtacagtccagcccaggttctcaccttgatgtcggccccagagaggtcatctttagccatgatcaagtcgtccaaggtcacatcatcggccagcgtcatcctgcttgtgtggatctgaaagatgcgcctcttggtcttttcatcgggcagggggaactcaattttcctgtcaatgcggcctgcgggtataaaaggtttccagtcacacccctgtggctcccccaggctccgctgtggctcgggaagcctgtctcctcacacctgcagtttcagagggaaacttcccttgtgggaagggtccaaatcttgaaaagtgaacactactctttgtaaatatccacgtttgaattcatcccgtttaaaagaaatcctctctcctctggtaccttcagaaacacacaaactagctactgctgcttttggtgctacccgaatgcgaaattaactggagctaccataggagctatttcttcagaaaaaagactattcattacgggaaagagaaacggtcacaacttaagactgcgatgaaaagggccacgctacgcctactacatcatgctcttagccattacctcagtggaacgcagcttttgggaagttattctacacttcaataatgtatttgccttgatgtgtatcatttttaaatcccctgaaagtgcacttaaacacgaacacgtataaacacactcattctccatgatgggacaaacgcaaatctgacctggtctgataagtgctggatccaaagtttctattcggtttgtggccatgataactttcacgtcaccccttgaatcaaatccatccaactggttcaacagttccaacattgttcgctggatttctctttcaccaccggaatttgaatcgtatctttgaaaaagaagagaagggatgaaaaccgaactgatctgctgaaggggaattataaaaacacctctgatgccctcaattctggcaacaaaatcagcacagcctcccagccaccacataatcttacttaaactgtagatgttttcgtgcctgagatggcatcattaattcagattgcacgtttggtatctgagcccccgacccaaccatgagctcctggaaagccttgtgacaatggctgtgtccccagagtgcagatgatgcctggctcagagtagaaactcaaggcatggctgcacactaatctccagatggtcacgactcccgggtggttgtcacctggcacccaggagcagagcctaaagcatccacagccacgtacagaaggagccaaggcaaacccatgtgcaagccacacaggcagtgctccgtgatcattctcagacaagagctacgaggtctttacctataaaggacacacagagaaaaatgtacctttttgttccaatggcatcaatttcatcaataaacacgatggatggcgcgtgttcttctgcaactcgaaataactcccgaacgagtttgggcccatcacctaggtacttctgaataagttcagagccaaccactcttaggaaagtggctgaggtttggtttgctactgctttggctaataaggttttacctattttaggttagaaaaagaaagacaaagtgaaaaaaccctcaagtgctgtcttaactcgaaaaccctgtcactaccacctaaaacgggcataaaaaacgggcagatccctccgatgaaaaggcatgccaccattccagtgtcttgacattacgttctccaaggcagataagaggaaattcagaatgttctgattatttttaaccatcttcctaaagtcatcatcatagtgtcagaaaatacactttactgggttattcaaacttgcatagaatattattaacccgacgcatgccaccagggtttgggatccaaactctgtgaaacaatcagtgatggaaaaacagcctgagaaccctaggtctgacctaaggaaacactctttagcactaggcctgcagcccccggggccacccgaggcgtcgtggctgtgctggctgggcttccccgaggctcagctgcgacggggccagctcccagtgaaacccacaaatgatagctcttcagacttttctcagtctctgttgtgtccttgtgaggaacttcctctctccaatctcagggaagatctcaaacatttccagtcctgccccgttccttgagatttctatttcaggtcaaaaacaagagatctggcagccattttgtgaactttagggctggaagaccttggcccctttgatggtgagtgaggacaggggcacagggccaagcaggagcatcaggacacggtggcagttagagcagggctggtaaaggaccaaccttaggcccgcgggggaaggggaggaggctgccggggagtaacacggaagacttagttcaaatgggaagaaggacgaggcgctaagctttactacaacatgtggccacgacatccttgtggtgagacagacagagggctgggtgtgaaggcttaaagtgcggagactccccgagagaaccgactagggctggtgaacagaagacaaaaaggacctttctaagtgggtggcatctttcagtccagaagcggccaaggccagctgctgtggcactgcagtagccagagggctcaccgaaccggcttcttcctcctcctgtcaggcccaccaccctgtgcttcaccccagctcctcagatcagtccccagcagtgcacatgcaccaaaggaggcctctcttccagcctcagccctgttgccagctcactcccagagcgaccgcggccttgggctagtggtcactggcctctctgacacttgatttcctgggctgtaagaggacaggctgcagaagctccatgcctccggagctcgtctccacttgtctcccagaccctccactgtgggcagtccccagtcctctcaggatcctcctgggaacgtggtttcaattcattcaaataactgtgcttcctctggaatttacacagcgatgtactgctaagtcctggactgtacaacttactcaggtcaactagtcacacggtgaaccaaatatatgtgtttttatcttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]