GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:35:02, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       XR_003958599            7344 bp    RNA     linear   VRT 13-MAR-2020
DEFINITION  PREDICTED: Taeniopygia guttata testis and ovary specific PAZ domain
            containing 1 (TOPAZ1), transcript variant X3, misc_RNA.
ACCESSION   XR_003958599
VERSION     XR_003958599.2
DBLINK      BioProject: PRJNA577119
KEYWORDS    RefSeq.
SOURCE      Taeniopygia guttata (zebra finch)
  ORGANISM  Taeniopygia guttata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Estrildidae; Estrildinae; Taeniopygia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045000.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 13, 2020 this sequence version replaced XR_003958599.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Taeniopygia guttata Annotation
                                           Release 105
            Annotation Version          :: 105
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7344
                     /organism="Taeniopygia guttata"
                     /mol_type="transcribed RNA"
                     /isolate="Blue55"
                     /db_xref="taxon:59729"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="Muscle, blood, brain"
                     /dev_stage="adult"
                     /country="USA"
                     /lat_lon="36.0014 N 78.9382 W"
                     /collected_by="Matt Biegler, Duke University and
                     Rockefeller University"
     gene            1..7344
                     /gene="TOPAZ1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101234144"
     misc_RNA        1..7344
                     /gene="TOPAZ1"
                     /product="testis and ovary specific PAZ domain containing
                     1, transcript variant X3"
                     /db_xref="GeneID:101234144"
ORIGIN      
ggggcggcacgacggctgcgcagcgcaaagcgaggcacgcccgcctggccgggggctgccgacagcggggcacggccgcccggcggagccgcgctcgccgcccccagcgccggggttgaaccgcgcagacggcaccgctgatccggcgagagggcgagcgcagccaggcgggtgttgctgccgcctcgcctcgcctcgccgcggagccgccctcacgccgccgcaccaccattgcccgccggcgcggcgcagctcggctctcggggcgggcaggcggcgctcggacgaggcgtcaggggacggatcggtagacgagggcagatagtgaaggggagagagagggtgggaaagcggcgcgggaggctgcaagcagcggccttcttgagtctggagaggtggggggccgcttccttcaccgccccggtctgttagaggttgctccgggtgtgtgtttgggggtgggggcagtgagggtgtcaggaagggcttgtcggtggccgtggtttttctctgggccgcctgggcttcctttctgtcgatctgggctcccccgactgttcccggaggcggcagccgtggggaggttgtctccctctcccaggtcgggcctgcacccatcgtggatgcgggctggagaaaggtgcgctggtgagtggggtttgtgggttctgctgctgtctctgcgccgccgagatgccgcagctgaggtcaggcagagtggtgagaggcagcgaggtaaagccatttgacccggaggtcagcagccccggcttttcccgggcagggtgtgagtcagaggggaaactggtaggcgagcagagtcgtcaccgggcaccaaagagaaagcctgagcagcccttaccttcctttgcacaatctgccagggtttctcagtgtttttttgctcttcctgtgcccattcagaaggagcaaggtgacaaaagacagaaattcccaggtaaaaaaacaaagggaatccagcacaggaagttttccagaagaagcaaggctgtaccttcactagtttcaaagacagctgagtgtgaagattggcaagcagcagccacggctgcaccagtgtgttgggaagagactctgagagggacaggtcaaactcaacagctgtttttctcaggagctcctttgcagaaaaaattctcagcagagattgaaaggaatgaacattgctcagaagacctgaacttttctggcttccacaagggtacagggagctcagaaacagaaggcaaacattcctgtataaaaataaaattaaaagtcccatccttgaagagggaaattgagagcacagagagacatgggatatcctgttttccagaaccagaagttcttcaacccaaaaaggtcacatggagtaatgaagtgcaatgtactgactgcacaatgacacagaatatgcaaattccagattttaggaagaatttgggtgctcaggaagctgtccctgaaccaaaaccacaggaagaggctgatatgccagagaagttgaatgcgtgtccgttagttggatcaagaacactagggacacaggaagaaaagaaatgcttgggcaagaaagataggagatcagtggggaaaccaaaagtacatgatcccatggagagttctgccttgctaaaacagcatacacactgtccagagtccaggaaaggagcgctgtacagaaatgccttgctgccacagcagctgcaggatctgagcggacaaaaaaaaccaacaaccagaagaaagactcggaagcattgcatgaaagaagagcagcagagctcaagccctcagaaacggccagacagcccaggggaaagtgcagaggaaccgctgaaagcaactgagcaagactctggtacttcacaggctgtaaagaaggttaagacaaagcaaaacagcgtagaagattctaaggaaaaggagtctcactattctagatcttctacagtttctacttcagatgacactggaagcaagagctttttgtgccatgctgtaacaaaagagccgggtgtgcagtgtagaaaaaggcaacacagatctggtcaaatcaagcttttgcgaagtttaagtgtgactgcagctgaagaagtgatgaatacatctgcaaaatgtgatgctaaacatgtcctacaccattgtagtggcttgctctgtgcaactgaaaaaaatccagttgtggtattagagcactgtagttacatcaatacattagtgaagccttcagctagtggaactaccaacacttataagttaaatggattgttctgtgtagcccatggtactggagacctgaatgatagaatttgcatcactaatagaaagcaaaataagagatcactcataaaagatggtttatcacctaataaagaaaagagtgaaaatgaagaagactgtgtttcatgctgcctgagtgaaaacagtaagtgtttaaggggaaaaaagtggaatattggtagaaagcctagaaaaaagatgaaaatcacaaagaaatctgcagacatggctagtaaatgcgagttacaaacagaagcagtagttgccatgtcaagctcatgttcagtttcaggactaaatcatacaaatacagaaaaaaatactcaggaggtacaaactgtatcagcttggagaaagaacagtaccccattacttgcatttgaaacgggctttaagaagacatctgagctctctgcagtagtaaaagtagaaaattcaagcagtgtggcacattatgcctcagatagccttcgagtgttagctcagatccatgatgttcctgatcatcacaaaagcaagacaggaagaaatttgaacaaagttactaagaaattgcagcagtttacctgtcaaagaacaatacccatgactggtaaaaaagtttggcctgttgaatcttgtgccaggacttctgaatggtttcttaaaaaacataggtcaatctcagaaggaaaaagacttttaaaggctgcttttgaggattcctctggtaaaatcagtgttaaagctgtggaacatagtgcagtgactgggaatgtgagacagctggatttccatacatcattggcagaaattacaaaagaaattacacataaaaagatggatctaaatattgactgtcaggcttcacttgaaacaatggaatcctcttctgcagatatttatgagactttgacagtgaacaatgaaaatggggaatcaccagttaatacagataaaaatgccatggttttaaaccatgatgatgtgcaagaagttaaagcaaccttgacttttacagcaaaaccagaagatgaaggagatgtaacagaaagaaacctgtctgtgacagtccagaaggacacaacgaaactaaaggataaaaatgaaggagatgtgatggacagaaacctgcctgcaacagtccagaatggtacaataaaacaagaagataaagatgaaggagttgtgacaaacagaaacctgtctgtgacagtccagaaaaacacaacgaaacaaaaggataaaaatgatggagatgtgacaaacggaaacctgcctgcaacagtacagaatggtataacaaaacaaaatgataataatgaaggagatgtgacaaatagaaacttgtctgtgacactccagagtggtacttcttcaagtaactcaaacagtataaacttcagccctaaagtatcagtggtgaaccagatattttctgatttaaacctaattaaaccattagcctctggaaacctgacaaaattcaaaattcctttatgcaaaaacaaacctaaatccaagaaacaggaatctgtccattcatttgaaagaaaaatttgtagtccactagagcttcttgaaagtactagtccaggaaggcagaagacaggtgaagagactttcttggtaaaatctgagcagcgtcctctttctgtcatgagtgatgctacatctccagattccatacagaaaaaagcagatgagattgatagtaaggacttccagcacaatggctctgtaaacctctctgatgagatgtctgtgtttcctgaaaatttttctgcatatccacatcctcctcttgatggacagccagagccatctctgcctgatttctatggtactgaatgtgtgctgaaatctagttttcctgatcattcttggaatgcagtcgaccaccttactggattagaaataaatggtgatagaaaatcaagaggggatttttcgcaacacgaaagtcaaaatttaccggatattcttgaagcttacaatcaagatgttcttgtcatagatgtgattcaggatgaccctgacctttttggagccagtaatcaagaggagcttgcacctgcatgctgtgaaaattgggcagtgaaagcatcctctgcaaactgcattgaagacacagaggtgtatagtaagcctgagtctcccattacctcagaaaagacatattcagtagagagtagttttagatgcatgcaagaatctgcaaagtcaagtgatactgaaaattcctgtaatttagtgttaaaagctgaagatgtgaagacccacaactcctccagaagaagcagtccttcaggagatgttagtgaggactttcttaaagacagacaacagagcaaactagatgaacttttgactttaagtttggacgtggatgaaaagttcaagcttgcagatggagtgcctgatgttgaagaagaaaataagactggagctggaaaaagtgactgtaaatacaaagtgaactgtgaattgctatcaggattgccattgccattaaatgaccgaaaagtaaatctcttcagtggaactacagagatgaaatcctggacaaatggtaacaaatcttcaagaagtacttcactgccatcaaagaattgtggagattttgagccatggaagatggagaaaaatgcaagtgcttctcagtcagtccagcagatccttgatgcacttaacttgccccgtaaatactgcagatattacttcatgacttcacgtgggtgtgaaagagcaaaatgttggttctgtcatgttccaggacaaggggatgaaaagatttgcatggcaattcttaggacatacattagtatcaaagaatcaggcctcctaaaacgtgcagtccagatatttgtgcagtattacaaagaagttactcctggtgtggattttgcttctgaagtgctgaatgatcttcttgtttcattgctcaacaactgcttgttgccggaagtatttcagatattgaatgtaattgtacaaatcaagacactgccagctgtagatgttcttctgaaagtttttgagcatatggcttctttgaatataagaaatgctgtgcctacattaatcagtatcttctgtcagctcattgatgctggtatgttccttgagttagaacatttggactacattattaagttacttcaccaattacaagtttccagtagggaaatgagtactgttttgaacataaaatccagatttaaggaaagatattttgaaaagacatggatttttgactacaacttagcagtggctgaaattcagcattgcaaggaaaaaagggattggaccaagctgggagctttgtatcttaatgcaagaactggatgtgaacattttgaggatcttcagaaattgtttatatctattgctgaaattctaaccaacgattctgagacagaccaaccaggagtccctttttgtgattttgctgatacagtaatgaagaattcacagcataataaagcagacggacttttcattggaaggactgggataagcgtaatgtattcgtatcacaaagtactgcagtggataaagggaaggaaagttttggataaactgcatgagctacagatacattttaccgtcttgaaaggacttgtaggtgcagggaggtcagcatccagatgtcagattgttaataaagccgcagaaatctttcttttttctggaaatttggatggagcaacaagggtattgagagagtcagagtggatcactgatgcaccattgtggccctgtgataaaatggacatcatcaatcgacataatctattatgtgcaatagtgcacaaatacttgaagaagagtttgtacaggcaggcatttgaagttctgcagaacttaccaggtttgcagaaacattctgttattatagatgcttctcaacacagctccctgtttaacaagctgataaatgcctgttttgagaacaagaaccttggggtctcatcttctgcagtagacttcatgctttccaaaaaaattgctattgattttattttacttagaggattaatcacagctttgggaagaagttctttatggtccaaagctaggacctattacaaaagtaagttgcttcttaaacaatatcttccccttacattctttagataatgtgctcataacatttcagtatgcttaaaaaaaaaataaaaaacagtactttctgtgtcactctcaggaatttacttgtaacctaaaatacttattaggaaatggtgagtcgaaaataagaatcagtgcatactacctggcatgaaataaatgtaattgtgataaaattaattttttacattcagttccagaatttcaagtatatgagctctgaaatggttgaaaagtgcatcatcttcacattttcatttaggcaaattagatttcctgatacttctttctagaagtgtactagcattactgtgggggtaaaattattaatatttaagatttgagaagtctggctaattattttatcctaattataagaaaattcatttcaactaaaagctaatagtctgtaattgtttacaactcccctattctgagctaagataatactgggtgctccagtctgcatagggtctgtccatatggtcacattatttactgtttgattctgtctcagaatcgttgagattagcagactgctttaagagaccatcctttctgggatggatacttccttttgttaacattggaattagtttttcctaatctcttttttttcccctgaaatgctgtatatgttgggttgctggaatcacttgactgaagagaagggaacaaagcaggagatgctgttcaaatgttctctcactttgaccatgattaacagcttctgtctgacctgcctaaattgtatatgtgttatcacaggctcgctgtccccagacttctggcagagctttttaatcatagctggtaaaactcattgaaaaaaaaattccagtattttataactatgctttatcactgggttgctacccagagctgcagggaaatttatatcagaaattcctgaagattccctcttacctgtctgaagttgagatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]