GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-06-02 01:14:29, GGRNA.v2 : RefSeq release 200 (May, 2020)

LOCUS       XR_003912964            3740 bp    RNA     linear   MAM 14-JUL-2019
DEFINITION  PREDICTED: Suricata suricatta NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X4,
            misc_RNA.
ACCESSION   XR_003912964
VERSION     XR_003912964.1
DBLINK      BioProject: PRJNA553468
KEYWORDS    RefSeq.
SOURCE      Suricata suricatta (meerkat)
  ORGANISM  Suricata suricatta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia;
            Herpestidae; Suricata.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_043708.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Suricata suricatta Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3740
                     /organism="Suricata suricatta"
                     /mol_type="transcribed RNA"
                     /isolate="VVHF042"
                     /db_xref="taxon:37032"
                     /chromosome="9"
                     /country="South Africa: Kalahari Meerkat Project"
                     /lat_lon="26.98 S 21.83 E"
                     /collection_date="02-Feb-2016"
     gene            1..3740
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 7 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:115301093"
     misc_RNA        1..3740
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X4"
                     /db_xref="GeneID:115301093"
ORIGIN      
gtgcaccgcaaccgcgaaggcctcattaccggcgtccgctcgcgggcgccatttctgtaggggggaacggcagtgcggcctgtggccatggcgctgttcccggcctttgcaggcattggtgaggcttcccatagcggcagcgccaggaaagagttagactggctgagcaacccaagcttctgcgccggagccgcagcctctctgagccggcagggcggaggcgccacggccctgctctccgaggggtcaccgccgaccaggagccctctgaagtcagagccttcggatgaaagtgacgctaacaaaaagcccaaacaagcaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcaccacaagaaaaccaagagaaaacatggccagtccagtagcagtgggtctgagccggatagtgattctgaaaaggacaagacttccagaagccttcgagacagtaagaaggaatcagagaaaccaaaccaggaaggggctgctgccgccgacactgggcaccgcttggtctggcttgaggacgtccaggccctcacgggggagaccttccggacagataagaaaccggatcctgcaaactgggagtataagtctctctaccgaggagacatagcaagatacaagaggaaaggagactcctgcctcggccttaaccctaagaagcagtgtatatcctgggagggggccgccaccgagaagaagcattcacacaagcacgtggagcgctattttacgaagaagagcgtgggactgatgagcgttgacggagtcgccatttgtggtaaaaccgaacctccctcatctgagccggtctcgtttatcccggtgaagggctcggatgagggggctcctcctgtgacgacctggttgaaccctctggggatttacgatcagtccaccacgcagtggttacaagggcaaggtcctccagagcaagaatcaaagcagctggactcccagacagacaaagagagtgccctgctcaaggccaaggtggaggactttaaccggagagtccgggagaacccccgggatattcagctgtggatggccttcgttgcttttcaggacgaggtcatgaagagccctggcctgtacgccatcgaggaaggagagcaggacaggcggaggcggtccctgcggctcgtgctggagaagaagctggccgtcctggagcgggccatcgagagcaaccagagcagcgtggacctgaagctcgccaggctggtgctctgctccgagttctgggagccctccgcgctggccaaagagtggcagaagctcatcttcctgcaccccaacaacacggcgctttggcagaaatacctgttattttgccagagccagtttagcacctttaccgtctcaaaaattcacagtctctatggaaagtgcctgagcaccctgtctgccgtgaaggacggcagcatcctgtcgcaccccgccttgccgggcactgaagaggccatgtttgctctgtttctccagcattgccacttcctgcggcaggccggtcactcggagaaggcgatctctcttttccaggccatggtcgacttcaccttcttcaaacccgacagcgtgaaagacctgcccaccaaaggacaggtggaattctttgagcccttctgggacagcggggagccccgggctggggagaagggcgcccgaggctggagagcgtggatgcaccagcaggagcgcggcggctgggtggtcatcagtccagatgacgacgatgatgaaccagaagatgaggaccaggaaataagggataagtctctgccgcggtggcagatctggcttgccgccgagcggtcccgagaccagaggcactggcggccgtggcgccctgataagaccaagaagcaaaccgaggaagactgtgaggacccagagagacaggtgctgtttgatgacatcgcacagtccctaatccgtctctccagccaggatcttcagtttgggctggttgcggcctttctgcagttcctgggcgtgccttctggcctcagccctcccgcctcctgcctctacctggccatggatgagaacagcatcttcgataacggacttcacgatgaaatgccactgacttttctcaacctttccttctccggcgtcagctgtgttggccgctcggacccgctgggctgccggcgctggacgcggggtcacagccgggagggcgaggagttcatccgcaacatcttccacctcgtgatgcctttgttttcaggccgggagaggtctgagctctgcttctcctggttacggtacgagatcgcgaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacaaggaaagaactgcaagaaactagccaaaaatctccttaaggagcccgaaaaccgcaacaacttctgcctctggaggcagtatgctcatctggagtggttgcttggcaacacggaggatgccaggaaggtgttcgatgcggcgctcagcatggcggggggcggcggcctgcaggaccgcgagctgtgtgagctcggcctcctgtacgccgggctggaggccgagctgccggccgggtcgaggggggccgccgcggcgcgagccgtgcacgtcctgaccaggctgaccgaccaggggccctacaggccctactccgggcaggtgctggccgttcacgtcttgaaggctcgcaaggcttacgagcacgtgctgcaggactgtttgggtgacagctgtgtccccgggccagctcccagcgactcctccccccgttggatcagcctggtgaaatgcttcatgctcttccagtatttgacggtggggatcgatgcagccgtgcgggtgtacgagcaggtatttgcaaaactgaagggctctgtcccccccgggggccgtggctcggaggacgggcccggcgcccagagcccaagcggcgcgctggaggccgttacgctgatgcacgccagcctgctcagattccacatgaaggtcagcccctaccccctggcccctctgcgacaggcgctctctgaggctctacagttgtacccgggcaaccaggtgctctggagggcgtacgtgcaggttcagagtaagtcccacacggccagtaagaccagaagattcttcgacgcagttaccaggtctaccaaactcttggagccttggttgtttgcgattgaggctgagcagatgaggaagaggctggtggaaagtgttcagaggtgagtccagacaccccgttcgtgtggcccccccgccctgccgggccgcagggctccagaagggagcatgggccggcgctggaggatgacctgtggaaagaggaatccgaggcttgcagatggcaacagcttgttaggggccttcgtggccgtcacgaggccatgctcgttgggatcctgaatgttgcttatggcctgtgggtggttggcggtcaggcttccagccatccgagctgtggtaaaagcatgttggccaaacgcccgagcctgaagtaggactctggactcagtcccgctcctccacttaccagctgtgtggccgtgggcaagtcacgtcacctctcacgggctccccttcggtaacggagtaagagcctccctcttagcgctgctcggaggggccccccagggtaggcggcagagaggtccgcgccaccatccccgagaccggcctggcgcatcgcatccaggccctgtttgaaaatgcgctgcgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]