LOCUS       XR_003850833             103 bp    RNA     linear   ROD 24-JUN-2019
DEFINITION  PREDICTED: Nannospalax galili U6 spliceosomal RNA (LOC115071755),
            ncRNA.
ACCESSION   XR_003850833
VERSION     XR_003850833.1
DBLINK      BioProject: PRJNA254049
KEYWORDS    RefSeq.
SOURCE      Nannospalax galili (Upper Galilee mountains blind mole rat)
  ORGANISM  Nannospalax galili
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Spalacidae; Spalacinae; Nannospalax.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_008345224.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nannospalax galili Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..103
                     /organism="Nannospalax galili"
                     /mol_type="transcribed RNA"
                     /isolate="Female #2095"
                     /db_xref="taxon:1026970"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="brain"
                     /country="Israel: Animal Facility of the Institute of
                     Evolution, University of Haifa"
     gene            1..103
                     /gene="LOC115071755"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:115071755"
     ncRNA           1..103
                     /ncRNA_class="snRNA"
                     /gene="LOC115071755"
                     /product="U6 spliceosomal RNA"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00026"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:115071755"
                     /db_xref="RFAM:RF00026"
ORIGIN      

gtgcttgcgtcggcatcacttacattaaaattggaatgatacagagattaccatggccctaggtcagaatgacctacaaattggtgaagcgttacattttttt

//