GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:28:15, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_003705204            3428 bp    RNA     linear   VRT 21-APR-2019
DEFINITION  PREDICTED: Podarcis muralis NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_003705204
VERSION     XR_003705204.1
DBLINK      BioProject: PRJNA529705
KEYWORDS    RefSeq.
SOURCE      Podarcis muralis (Common wall lizard)
  ORGANISM  Podarcis muralis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Laterata; Lacertibaenia; Lacertidae; Podarcis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041312.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Podarcis muralis Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3428
                     /organism="Podarcis muralis"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:64176"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /ecotype="yellow"
     gene            1..3428
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:114591107"
     misc_RNA        1..3428
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:114591107"
ORIGIN      
gcgctacgctgccgccatcttgtctcggcccacgcgatttcttccgtgggaacggcatccgggaagcgccgccgatgcttccgtgagcagggacgggatggctcttttcccggctttcgcgggcgctgctaaacccggggaggcgccagcgggcgagaccgagggctccaagagagaattgaactggctcaccaacccgagcttctgcagtgaagatgctctgagacttcaccagcatgctttaaaggccacagaccttgccttggacaaatccctgctccaaagaacaacctccagcttagagacattgggagaaagtgaagtcagcgaaagtgtccaaaaaccagccaagaaaagaaagaaaaagaaaaaacagcgagaccacaagaaagtaaaaaagagaagtagaaagcatcagggaacaagtgaattggaatcagatgctgatgatgtgaaagacgataaaaataatgaaaaagaagcagaattgaatttaggagacaaagcttcaaatgtgagcattcactccatctggctagatgatgttcaaggtgtgacagcagaagtattcagaacagataagaaaccagatcctgccaactggcagtataagtctctgtatcgagggaacattgcaagatacaggagaagaagcaacttctgtctgggcgttgatccaaggaggcaacatattgcctgggagagttcctcagcagagaaaaagccctcccataagcagcctgagcgttacttttccaaaggtggccggaagctgttgaatgcggatggcattcccgtcagcacaaaaagtcaaggctctttgtctagcccaactgcatggatacccattttggagcaggactcagctgatgttctggccacatgctgggcgaatcctcttgggatttatgatccagggaccacattgtggctgcaagggaaggggcccccggagcacgattcacgaaagctacgggaagcgcaagagagctctgagaatggggactcccgcctcctggccaaagtggaggactataacaggaaggtcagagaggaccctggagatatcaaagcatggatggattttgtttcttttcaggatgaagtcatgagaggccccagctgctatgccatcagcgagggagagcgggaaacgaggaaggtgtccctcaaactcatcttggagaagaagctggccattctggaaagagctatcgagagcaacccaaacaatgccgacctgaaactggccaggctcaagctttgcacggagttttgggagccgtcggctgtgatcaaggaatggcagaaattggtgttcttgcatccaaacaacccggccctgtggcagaaatatctcctgttctgccagagtcagttcagcacctttgccgtttccaaagttcacagtctgtacgggaaatgcctgagtactttgtcggcggtgcatgatggcagtatggtgtctcatccagccctgccacacacagaggaagccatgctagccatcttccttcagcagtgccatttcctccggcaggccggccattcggagaaagcaatatccttgttccaggccctgattgacttcaccttcctgaaaccagatagcgtaagggaactgccaacaaggcggcaggtggagttctttgagccgttttgggacagtggcgagcctcggattggagaaaaaggagcgaaaggctggaaggcctggatgcaccaacaagaaaagggtggttgggttgccatcaacccacctgatgaagatgaggaagacgcggaggaggaggaagaaataaaggatagatctctacccaagtggcaaaactggcttcacgttgaacgttctcgtgaaggaaggcactggctgccttggcggccggacaaaaccaagaaggagacagtagatgattgtgaagatccagagagacaggtcctgtttgatgaccttggtccatcgctaatacaaatttccagtccagatcttcagtttcagctgctctgctcgtttctgcaattcttaggcgtgccatgtgagtgcagcctccttccttccttcctctacacagcaatggatgagaacaacatctttgaggatcggcagcatggccaaggacccctgacttcttttgacctgtcacttcctggagtcagtagaattggccagatggactcgatgctccaaggagttagacatattggccaccccaaagaaggggaggagttcatacagaatttcttccatatgattctgcctctgctttcaggaaaagaaaaatctaatctatccaacttttggcttcagtatgaagtctctaaggtcattcagtgtttggaaacaggcaacaaaaagaaactgaaatggcaagggaagagaagtaagaaattagccaagaaccttcttaagacccatgagaacagaaacaatgtttccctttggcgactctacgcctacctggagtggttgcttggcaacgtggaagatgctaggaaagtttttgatatgtctctgagcacggcaggaacggctgggatccagaacccccagctctgtaatctgggcctgctttatgccgaactggaagcagagttgctggggagccaggagggaacgctcgagtctcgcgccgttcacatattgaccaggctggccgagcaaggaccttacacaccatacagtggacagacatcatccgtgaacattttgagagctcgaaaaacatacgagcatcttctccaggattacttgagcgagagagccacctctaaacaagaacagatctgcggctctggccatctcgttggcttggttggttgctacacccttttccagtatttgactcttgggattgattctgcagtgtcgatatacaggcaggtttttgagaagctggaaggcgaaagctctggcggtcagaactgcactgccagccttgaagctgtcgcactgatgcatgtgcatttgctcagataccacatgagaacgagcgcctatcctttggctcctctccgcgaagcactgctggaggctttgaagaggtatcctagcaaccagcctctctggagggcgtatatccagatccaacgcaagtcgcacaatgctagcaaagcgcggcggttttttgacagcattgcaagggccgcgaagtcgctggagccatggctgtttgcaatcaaagctgaacagatgaggaaaaagcttgtggaaagtgtccaaagcctctggcgatgtgtacgcaaccatccccgaaaccgggataaccaatcgaatcaaagctttatttgaacatgccattgagactgaaaatggtgctcattgtccattgctttggaggctatatataaactttatggtttctttaggagataaaggaaaaagtaaaggagtgttttatagagcgcttcaaaactgcccctggacaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]