GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:24:35, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_003682141            3708 bp    RNA     linear   MAM 21-MAR-2019
DEFINITION  PREDICTED: Physeter catodon NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_003682141
VERSION     XR_003682141.1
DBLINK      BioProject: PRJNA434122
KEYWORDS    RefSeq.
SOURCE      Physeter catodon (sperm whale)
  ORGANISM  Physeter catodon
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Cetacea;
            Odontoceti; Physeteridae; Physeter.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041224.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Physeter catodon Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3708
                     /organism="Physeter catodon"
                     /mol_type="transcribed RNA"
                     /isolate="SW-GA"
                     /db_xref="taxon:9755"
                     /chromosome="11"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..3708
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:102976275"
     misc_RNA        1..3708
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:102976275"
ORIGIN      
tggagtgaaaaggcggtgcggcctgttatcatggcgctgttccccgcctttgcgggtgttagtgaggcgcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccataacatctctgagccaacaaactgaagaggccacagcctttgcttctgaagagtcgctactgaccaggagtcctctgaagtcagagccttcagatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagtaaacgtgggcagtccagtagcagtggatctgagtcatatactgattctgaaaaggacagatcttgcggaaacatcagaggcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgagcattaacggagttgccattagcagtaaaactgaacctccctcatcggagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaagctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaggaatccaagcagcccggttcacagcccgacagagagaacgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgagatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtacgccatcgaggaaggagagcaggaaaagcagaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcgccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccctgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccctggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtcgaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgaggaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccagagaggcaggtgttgtttgatgatattggacagtctctgatccgactttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcagcctttcattttccggcgtcagctgtgtcggacgcacggaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcagcatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctccttaaggagccagacaaccgcaacaactttggcctctggaagcagtatgcacatctggagtggctgctcggcaacacagaggacgccagaagagttttcgatacagcgctcagcatagcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggccgcctcagcccgagccattcatgtattgaccagactgaccgagaacggggcctacgggccctacaccgggcaagtcttggccgttcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaagatctctgtttccgcagagggccctggcctggagggcagtgccagcccccagaacctgagcggtgtcctcgaggccgtcaccctgatgcacacgagcctgctcagattccacatgaaagtcgccgtctaccctctggcgcctctgcgagaggctctctcggaggctttaaagttgtatccgggcaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgtttgcaattgaagctgagaaaatgaggaaaagactagtggaaacggtgcagagggtagatggtagagaggtctacgccaccattcctgagaccggcctgacgcatcggatcagagccctatttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtacttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgctcgaggactagagaccaggaggggagtggggcgtgtctccggggcctccgcgcctgccccgtgggagccaggagataccagacgagacggtgacacatgcgtctgctgttgaacaactgccaccagctctgggggtgtgacggggcagcaggtattaaagtctgcagtccttttggtcagccagcttcctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]