GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:27:29, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       XR_003582214            5975 bp    RNA     linear   ROD 21-MAY-2020
DEFINITION  PREDICTED: Marmota flaviventris NRDE-2, necessary for RNA
            interference, domain containing (Nrde2), transcript variant X2,
            misc_RNA.
ACCESSION   XR_003582214
VERSION     XR_003582214.1
DBLINK      BioProject: PRJNA516936
KEYWORDS    RefSeq.
SOURCE      Marmota flaviventris (yellow-bellied marmot)
  ORGANISM  Marmota flaviventris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Marmota.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023144657.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Marmota flaviventris Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5975
                     /organism="Marmota flaviventris"
                     /mol_type="transcribed RNA"
                     /isolate="SJ_83"
                     /db_xref="taxon:93162"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..5975
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, and 99% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     3 samples with support for all annotated introns"
                     /db_xref="GeneID:114089629"
     misc_RNA        1..5975
                     /gene="Nrde2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:114089629"
ORIGIN      
gccatttccgtagagaggaacggcggagcggcctgtgtccatggcgctgttcccagcctttgcgggcgttagtgaggcccccgatggtgggggttccaggaaagaattagactggctgagtaacccaagtttttgtgtcggaactgtaactaccctgagccaacaaactgaagaggccacagctcttgtttctgaagggtcatcaccaacaaggagtcctctgaaatcagagccttcagatgaaagtgatgctagcagaaagctcacacaaataatcaggagaaagaagaaggaaaaaaagaaaaaaaggaagcatcagcaccacaagaaaaccaagaggaagcaccggcagtcgagcagcagcgagtctgagccagattctgattcaggaaaggacagatcttccaggagcatcagaagcagccagaagcaagctgagcaacccaatcaaggaaataatactgctgctgatgctggacttcgctctgtctggcttgaggacattcagtctctgacaggagaaaccttcagaacagataagaaacccgatcctgcaaactgggagtataagtctctctaccgaggggatattgcaagatacaagaggaaaggagactcctgcctgggcattaacccgaagaagcagtgcatatcttgggaaggggcttcctcaacaaagaagcgtgcgcacaggcacgttgaacgctattttacgaagaagagcgtggggttgatgagcgttgatggcgtttctgttagcagtagaactgatcctccttctgcagagccggtcttgtttatccccgtgaaggacttggatgatatggcttctcctgttacaacctggttgaatcctttggggatttatgatcggtcaaccacacagtggttacaaggacagggtccttcagaagcagaatcaaagcagccagactcacagctggacagagagaatgctcttctcaaggcaaaggtggaggagtttaataggaaggttcgggagaaccctcgggatattcagctgtggatggcatttgttgcttttcaggatgaggtcatgaggagtcctggcctgtatgctatggaggaaggagaacaggagaagagaaagaagtccctgaagctcatcctggagaagaagctggccatcttggagcgggccattgagagcaaccagagcagcatcgatctcaagctcgccaagctgaagctctgtgcggagttctgggagcctgctgcgctggtcaaagagtggcagaaactggtctttttacatcccaataacacggtcctttggcagaaataccttttgttttgtcagagccagtttagcactttttcaatatcaaaaattcacagtctttatggaaagtgcttgagcactctgtctgctgttaaggatggcagcatcttatctcaccctgcgctgcctggcatagaagaggccatgtttgcactccttcttcagcagtgccactttctgcggcaggctggccactcagagaaggccgtgtctttgttccaggccatggttgacttcactttcttcaaacctgacagtgtgaaagatctgcctaccaaattacaggtggaattctttgagcccttctgggacagtggagagccacggcctggggagaaaggagcgagaggctggcgagcgtggatgcaccagcaggagcggggtggctgggtggtcatcaatccagatgaggatgatgacgagccagaagaggatgaccaggagataaaagagaagactctgcccaggtggcagatctggcttgctgctgagcgttcccgagatcaaaggcactggcggccctggcgccctgataagaccaagaaacaaactgaggaagactgtgaggatcccgagagacaggtgttgtttgatgatattggacaatctctgatcaggctttccagccaagagcttcagttccagttgatcgaggcctttctgcagttcttgggtgtgccttctggctttgtccctccagcctcctgcctgtacctggccatggatgagagcagcatctttgatagtggactctgtgatgaaaagcccttgacttttttcaacctttcattttctggcattagctgtgttggctgcatggaccggttgggctctctccgctggaccaggggtcacaatcgagagggcgaggagttcattcgcaatgtcttccaccttgtgatgcctttgttttcgggcaagcaaaagtctcagctctgcttctcctggttacggtacgagattgcaaaggtcatttggtgtctgcacactaaaaacaagaagagattaaagtcacaggggaagaactgcaaaaaattagccaagaatctccttaaagagccagaaaaccgtaataatttttgcctctggaagcagtacgcacatctggagtggttgcttggcaacatagaggatgcccgaaaagtttttgatacagccctcagtatggtgggcagcagcgagctgaaggaccgtgaactttgtgaactcagtctcctctatgctgagctggaggtggagctgtcactggacttgtcaggggccaccacggcccgagctgttcacatactaacccgactgacagagagcagtccctacgggcccttcactgggcaggtcttacccactaatgttttgaaagctcgaaaggcttacgagcatgcgctacaagactgtttgggtaagagctgtgtctctgatccaactcctgctgactccttgaactgcctgagtagcttggtcaaatgctttatgctgttccagtatttgaccgtagggattgatgctgccgtgcagatatatgaacagctatttgccaaactgaagggttctgttttctcagaaggctctggcatggaggacggtgccagctcccagaatctgaccagtgttcttgaagccatcacgctgatgcacacaagtctgctgaggttccacatgaaagttaatgtttaccctttgactccgctacgagaggcgctctcggaggctttgaggctgtatcccggcaaccaggttctttggaggtcatatgttcagattcagaataagtctcacagtgctagcaagaccagaaaattctttgatgcaatgaccaggtctgccaaacccatggagccgtggttatttgcaattgaagctgagaaaatgaggaaaagactggtagaaactgttcagagggtgggaggtagagagatccacgccaccatcccagagaccggcttaacacatcggatcagagccctgtttgagaacgcagtgcggagtgaccacggcagccagtgccccttactgtggaggatgtatttgaattttttgggagaggagaactgtggtgccccgctcacggctgacacgggagctgctccagggaggctggcctccatgttccttacgtgtgcgcgactcggctctgggggctgagggtgaaggaagggggcgcctctgtgtgagccctgtcctgcccctctgaagactcattggcaggatcaggatgtgcacagagatggtaaagtgtgaccatttgcccactgcataggatgccagtcgctgaaacaaattttcaaaagagttattcacaaggcagctgagttggagtaggaggccacacatctccctgcctgagggtaggtgtgttggatatttatggggtaaagaagcagggtgatctgtggtgtggggagaatgattggaagatgaagtaatctgtgtttcatgcacatgtaatgaaacttcatggctctttatgagacacatgtacagaaaacagaggtgcacgatctgaagaaggtagagattttggccctctgatggcaaaaggtcttcactggacacctgcgcaggcccaaatgaagagttggtggtttcaacaaatttgccaagtccctgaaaagtaacctaggcagctgttacaatcatgacccacgcgtcagaggtgtcatctgtagctcagcttgtgagagactaagaatatatagctcagctccgtgacctccagaattagtgatctgtaaagccagtaaaaatcaggtaactaaagtgggaaaggggcttcagagagaagtacaaagcgtcggttcacatatacgaggctaggccagccacgtttgttaattatcagagttaagattccagtcttcatggagtcttggagactgaggtgagggttaccttcccaacagtggctctcagtttcttgggagatgcttctgactggcaaaaggtagatatttataactgggatcctctcttttagtaaatgcccggcagatggttggccccggtgagcaagagcagctctcttccttcatcagctctgtcttctttggttccatgcagagactcagttggtgccctcaggtgctcctggcttgcctgaggacacacatttacccagtcataataccgtgggggtgacaggagtgtcacagaaactccagaaaagagtgtatcacccccccagttatgtttcattcctgaaggaatcttacaaggagtcttgggtgttaagatgacatttagatggtgatagagggaccaggagagctggtagtggccatggactcttctctcacttgaggcttgctctacccacaggtgaaggcatgtccaaggccgtgtcttagaatacaaaatcatgggtagaaaacacatggtcaccactgagttctcacctggcatcaagctcttccacccctgatgcagaaaaggacagtgttttcctgtggcctgttgatgaaggaaatgccactgaaaagagtatagtggtttattgggctccaggattctgcacttggtagaagacatagtaatatagtttttcttattctttcaaaaaggaagaaaaggttcagtttagtcaggagttaggagaggacattgacgcatactgacgtgggaaggagcacaccggctgcttagttgtgaattgagtggcccagcctcagaactggaggcattcagtagaaaggacacatgggagtctcctgagcccttgtggctggctcttggagacgttgagccttgcccaaagcagggttctcatagatgttgttacagtccaagctgtagtcccttgtgaccgtgggagtgaaccttcaagattgaaaaatggagttcccgagcagcagtttggatctctggatgctgcagtccaggtttccaggagcccagtcattagctcttccttctctgctggctgcagcatgctggctgtgtggctagggagagccagtgtccactagaacacgatcctgagggagcaggctgggtggacaagcacagagacagacttgagctcccggggctctgctcacgccagccagcaggtactgtcctgggtagctggcttcccaggaaggtcaggagaggtccccagcaatggctccttccacactgggctgggaacacagtggtggctgactttgagatgaaggttttagatctagagagaaggccggctgagaacctgcacacactcagactgaaatttctgatggaaaaatttaataaggtgaaatctggcaaatggggtaagctattggagaaatgagatagtcctgattatttcatttctctaaaagacagctttcatccagtggcacgttctaaagcaaaggtttttttcatttgcacaacttatcaagttcaccagcttcatcttgcagatgcagaatgaggcaggtggttcccagtacaggagggggaacaggattgctaataaaagtgctcagcatcaacatggggccatttgaagagggaaatgtctaccacatagcaggggcctagagagcatcttctggtatctgggcgcattccgttcagccaccgtgatggtaccgggccatccacagagcctgcctacgcagctggggctgtatgccatgcttccttaggaaacaaagacagaagcaaaggtgtgttctacaaagcacttcagaattgtccctgggca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]