2025-03-24 03:11:00, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_003382616 617 bp RNA linear VRT 15-OCT-2018 DEFINITION PREDICTED: Zonotrichia albicollis uncharacterized LOC113460778 (LOC113460778), ncRNA. ACCESSION XR_003382616 VERSION XR_003382616.1 DBLINK BioProject: PRJNA217032 KEYWORDS RefSeq. SOURCE Zonotrichia albicollis (white-throated sparrow) ORGANISM Zonotrichia albicollis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Passerellidae; Zonotrichia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_005084197.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Zonotrichia albicollis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..617 /organism="Zonotrichia albicollis" /mol_type="transcribed RNA" /isolate="Tan morph" /db_xref="taxon:44394" /chromosome="Unknown" /sex="male" /tissue_type="hematocrit" gene 1..617 /gene="LOC113460778" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:113460778" ncRNA 1..617 /ncRNA_class="lncRNA" /gene="LOC113460778" /product="uncharacterized LOC113460778" /db_xref="GeneID:113460778" ORIGIN
gtcagtgtgacctgaagctcaggcagctcttcctgggggagaacaacccagaacaggaataaaaaaggagattcaccctcagtggaaccaggacctcaaaactgaggataaacccccacaattcctgtgaaagggaagatgttaagtgcaatccatgaggaattccctgactcagggagattttgccttgaggtcaatgtgacctgaacctcaggcagttctagctggcagagaacaacccagatcaggaataaaaaggagattcacccccagtggaaccagaatgtcagaactgaggataaacccccacaatttctgtgaaaggggagatgttaaatgcaattcaagaggaggaattccctgacacagggagattttgccttgaggtcagtgtgacctaagctcaggcagctcttcctcggggagaaaaacccagatcaggaataaaaaaagagattcacccccagtggaaccagaatgtcagaattgaggataaatcaccccccaattcccatgaaaggggaggaattccctgacacagggagattttgcctcgaggtcagtgtgacctgaaggtccaagctcaggcagcttttcctgggggagaacaaaccaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]