LOCUS       XR_003382616             617 bp    RNA     linear   VRT 15-OCT-2018
DEFINITION  PREDICTED: Zonotrichia albicollis uncharacterized LOC113460778
            (LOC113460778), ncRNA.
ACCESSION   XR_003382616
VERSION     XR_003382616.1
DBLINK      BioProject: PRJNA217032
KEYWORDS    RefSeq.
SOURCE      Zonotrichia albicollis (white-throated sparrow)
  ORGANISM  Zonotrichia albicollis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Passerellidae; Zonotrichia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005084197.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Zonotrichia albicollis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..617
                     /organism="Zonotrichia albicollis"
                     /mol_type="transcribed RNA"
                     /isolate="Tan morph"
                     /db_xref="taxon:44394"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="hematocrit"
     gene            1..617
                     /gene="LOC113460778"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 15 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:113460778"
     ncRNA           1..617
                     /ncRNA_class="lncRNA"
                     /gene="LOC113460778"
                     /product="uncharacterized LOC113460778"
                     /db_xref="GeneID:113460778"
ORIGIN      

gtcagtgtgacctgaagctcaggcagctcttcctgggggagaacaacccagaacaggaataaaaaaggagattcaccctcagtggaaccaggacctcaaaactgaggataaacccccacaattcctgtgaaagggaagatgttaagtgcaatccatgaggaattccctgactcagggagattttgccttgaggtcaatgtgacctgaacctcaggcagttctagctggcagagaacaacccagatcaggaataaaaaggagattcacccccagtggaaccagaatgtcagaactgaggataaacccccacaatttctgtgaaaggggagatgttaaatgcaattcaagaggaggaattccctgacacagggagattttgccttgaggtcagtgtgacctaagctcaggcagctcttcctcggggagaaaaacccagatcaggaataaaaaaagagattcacccccagtggaaccagaatgtcagaattgaggataaatcaccccccaattcccatgaaaggggaggaattccctgacacagggagattttgcctcgaggtcagtgtgacctgaaggtccaagctcaggcagcttttcctgggggagaacaaaccaga

//