2025-07-08 14:50:22, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_003374214 153 bp RNA linear VRT 11-OCT-2018 DEFINITION PREDICTED: Pseudonaja textilis uncharacterized LOC113437314 (LOC113437314), ncRNA. ACCESSION XR_003374214 VERSION XR_003374214.1 DBLINK BioProject: PRJNA495355 KEYWORDS RefSeq. SOURCE Pseudonaja textilis ORGANISM Pseudonaja textilis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Toxicofera; Serpentes; Colubroidea; Elapidae; Acanthophiinae; Pseudonaja. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_020769326.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pseudonaja textilis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..153 /organism="Pseudonaja textilis" /mol_type="transcribed RNA" /db_xref="taxon:8673" /chromosome="Unknown" gene 1..153 /gene="LOC113437314" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:113437314" ncRNA 1..153 /ncRNA_class="lncRNA" /gene="LOC113437314" /product="uncharacterized LOC113437314" /db_xref="GeneID:113437314" ORIGIN
acaatcatccaatggaacagcttgccatcagaagctgtgagtacttcatcacttgagactttcaagaagagattggactgtcatttttcagaaatggtgtaggtctcctgcttgggcaggggtttggactagattacctacaaggtcttttcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]