2025-03-14 18:00:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XR_002416247 594 bp RNA linear VRT 08-MAY-2024 DEFINITION PREDICTED: Columba livia uncharacterized LOC110360386 (LOC110360386), ncRNA. ACCESSION XR_002416247 VERSION XR_002416247.2 DBLINK BioProject: PRJNA1106885 KEYWORDS RefSeq. SOURCE Columba livia (rock pigeon) ORGANISM Columba livia Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Columbimorphae; Columbiformes; Columbidae; Columba. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_088614) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On May 8, 2024 this sequence version replaced XR_002416247.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036013475.1-RS_2024_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/03/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..594 /organism="Columba livia" /mol_type="transcribed RNA" /isolate="bColLiv1" /db_xref="taxon:8932" /chromosome="13" /sex="female" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="USA: Davis, CA" /lat_lon="38.513750 N 121.754494 W" /collection_date="2023-03-29" /breed="racing homer" gene 1..594 /gene="LOC110360386" /note="uncharacterized LOC110360386; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:110360386" ncRNA 1..594 /ncRNA_class="lncRNA" /gene="LOC110360386" /product="uncharacterized LOC110360386" /db_xref="GeneID:110360386" ORIGIN
tttcagtgaacgggtttctgacatttttgtcagcagagctggctgcagcagtggaggggagtgtgtgtttcacggcaatctcttcttggattctgaattttatttcatttaacttcatttttaagatgctctttttctggcgtgtgtaaggtgcctggacttacgctgttagcacagcaagctccatttgacatctcgcctgggctctaggatcattgttgcccactatttaaaactgtgattattttcttccttttcatccaccttggctgtaacagtttctacacaatgcagttcagagagttttgtggacaagacagcttatgtcgcatcacttgtgtaagaatgggagtttccatcaccaggagagcagcataaagtactcattcctggagacaaactgtggcacgtcctccaaccctgcagcactgagcagacatacaagttacaaggacatctgcaaatttagatcccatattttgtgccatgttgtgctacttgaaggcaagcggtacaagaaatgtttttgaaggaggattctgtccttcatttcttgtatagaccttcagaagcaagaaaatgacagaaatggac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]