GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 16:45:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_002397038             526 bp    RNA     linear   ROD 23-MAY-2017
DEFINITION  PREDICTED: Heterocephalus glaber uncharacterized LOC110350447
            (LOC110350447), ncRNA.
ACCESSION   XR_002397038
VERSION     XR_002397038.1
DBLINK      BioProject: PRJNA197330
KEYWORDS    RefSeq.
SOURCE      Heterocephalus glaber (naked mole-rat)
  ORGANISM  Heterocephalus glaber
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Bathyergidae; Heterocephalus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004624764.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Heterocephalus glaber Annotation
                                           Release 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..526
                     /organism="Heterocephalus glaber"
                     /mol_type="transcribed RNA"
                     /isolate="NMR 29"
                     /db_xref="taxon:10181"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..526
                     /gene="LOC110350447"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:110350447"
     ncRNA           1..526
                     /ncRNA_class="lncRNA"
                     /gene="LOC110350447"
                     /product="uncharacterized LOC110350447"
                     /db_xref="GeneID:110350447"
ORIGIN      
gtatgtcaccatatagggaaatccccattgaggtcactatgacctggggacttggggccatcaccttggtcactttctaatacctgccacaggcctaaacactcacccttgccatgtgatgtttcgatgatccagtctacaaataattgaagagacattgatcccttaaattgaggggatgaatgcagaagatgatgacagagtgagtgtgagcatgagatgttattttacttcaagttcatggtcaaatactgtccccagagtacccctcatggggccactcagctacacacagagaaagctgtgagagttgtcaggcctgagccagaggcatcagcccagcccgcttcctctcagctacaacaggaaatgagtgtccaggactctgctctgctaggggactacatgtgctctgtcttctgcaattacccagtcttgagcacagcacttggcacacagccgtccctctacgactactgactggatgaataaatgaatgagcaaaaggacagatgaatgcagccca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]