GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-10-23 02:06:08, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XR_001597394             319 bp    RNA     linear   MAM 28-SEP-2020
DEFINITION  PREDICTED: Rousettus aegyptiacus uncharacterized LOC107512815
            (LOC107512815), transcript variant X2, ncRNA.
ACCESSION   XR_001597394
VERSION     XR_001597394.2
DBLINK      BioProject: PRJNA665208
KEYWORDS    RefSeq.
SOURCE      Rousettus aegyptiacus (Egyptian rousette)
  ORGANISM  Rousettus aegyptiacus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
            Pteropodoidea; Pteropodidae; Rousettinae; Rousettus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023416286.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 28, 2020 this sequence version replaced XR_001597394.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rousettus aegyptiacus Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..319
                     /organism="Rousettus aegyptiacus"
                     /mol_type="transcribed RNA"
                     /isolate="mRouAeg1"
                     /db_xref="taxon:9407"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Berkeley (captive colony)"
                     /collection_date="2017"
                     /collected_by="Sonja Vernes"
     gene            1..319
                     /gene="LOC107512815"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:107512815"
     ncRNA           1..319
                     /ncRNA_class="lncRNA"
                     /gene="LOC107512815"
                     /product="uncharacterized LOC107512815, transcript variant
                     X2"
                     /db_xref="GeneID:107512815"
ORIGIN      
cgtcagccggcgctgaactgtgacggcagcgctcacggacccgcggctcgtgacggcattattgggggcgaccatcgacctggatattttttctgcatatgaaaccccgactgacaatctcttcttgcgacgctcgacggtgaagcgccctgttcttccagcagccacggcctctcatgagaagctgctgtcatttaagtgacaacctgcttacagcaaaacgacgccagacgccgttggtttgtgaacggccctcaccacgcggtggacgacgccccgcagaccggcgcccaaaccctgggagcctgcgaagacctcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]