ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-17 00:35:35, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_001597393 409 bp RNA linear MAM 28-SEP-2020
DEFINITION PREDICTED: Rousettus aegyptiacus uncharacterized LOC107512815
(LOC107512815), transcript variant X1, ncRNA.
ACCESSION XR_001597393
VERSION XR_001597393.2
DBLINK BioProject: PRJNA665208
KEYWORDS RefSeq.
SOURCE Rousettus aegyptiacus (Egyptian rousette)
ORGANISM Rousettus aegyptiacus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Chiroptera; Yinpterochiroptera;
Pteropodoidea; Pteropodidae; Rousettinae; Rousettus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_023416286.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
On Sep 28, 2020 this sequence version replaced XR_001597393.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Rousettus aegyptiacus Annotation
Release 101
Annotation Version :: 101
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..409
/organism="Rousettus aegyptiacus"
/mol_type="transcribed RNA"
/isolate="mRouAeg1"
/db_xref="taxon:9407"
/chromosome="Unknown"
/sex="male"
/tissue_type="muscle"
/dev_stage="adult"
/geo_loc_name="USA: Berkeley (captive colony)"
/collection_date="2017"
/collected_by="Sonja Vernes"
gene 1..409
/gene="LOC107512815"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 1 sample
with support for all annotated introns"
/db_xref="GeneID:107512815"
ncRNA 1..409
/ncRNA_class="lncRNA"
/gene="LOC107512815"
/product="uncharacterized LOC107512815, transcript variant
X1"
/db_xref="GeneID:107512815"
ORIGIN
cgtcagccggcgctgaactgtgacggcagcgctcacggacccgcggctcgtgacggcattattgggggcgaccatcgacctggatattttttctgcatatgaaaccccgactgacaatctcttcttgcgacgctcgacggtgaagcgccctgttcttccagcagccacggcctctcatgagaagctgctgtcatttaagtgacaacctgcttacaggaaacctctccatgaaagaagaagaaaacaggtttttatcgaataagcagtaaaccagaacgtgacgtgcatccaggcaatccagtgggacatctcacctggacagagccagactggtgcgacctgtcacacacacgttctcgggatgagcaccagcttgtcttcaggtaagaggacttgacggcaccattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]