2024-04-25 09:18:39, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001562778 444 bp RNA linear INV 14-MAR-2016 DEFINITION PREDICTED: Acropora digitifera uncharacterized LOC107337268 (LOC107337268), ncRNA. ACCESSION XR_001562778 VERSION XR_001562778.1 DBLINK BioProject: PRJNA314803 KEYWORDS RefSeq. SOURCE Acropora digitifera ORGANISM Acropora digitifera Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Astrocoeniina; Acroporidae; Acropora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015441154.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Acropora digitifera Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..444 /organism="Acropora digitifera" /mol_type="transcribed RNA" /db_xref="taxon:70779" /chromosome="Unknown" /country="Japan:Okinawa, Kunigami, Oku" gene 1..444 /gene="LOC107337268" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 41 samples with support for all annotated introns" /db_xref="GeneID:107337268" ncRNA 1..444 /ncRNA_class="lncRNA" /gene="LOC107337268" /product="uncharacterized LOC107337268" /db_xref="GeneID:107337268" ORIGIN
cagaatgggtgttcctcttgtggttttgcttgaattctgttctgagggtgataacgtcttgatgccgtcaatctcttcttgtctgctaatgagtggctcaaatttgttcccacgaaagaggtggaaaatccgttctttggacaaacaagtaattttgggattccagcatcttggtctttaatgtttggatcaccaatgcattggcatggaaacctattttagtgaggcagactcatgagttatgtacttaccataactttcacgtttgtttgatcactgttttgcgcttagtttagcaaggaacctctccatgttacgggtcattatttgtagtatttgctcaaaacgttaccatgaaacagctaccacgtgtcaaatccagtgtatcaagtttttcccgtcttccataatctctaaatcgaactacaccaatttaccaggagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]