LOCUS       XM_069648350            1891 bp    mRNA    linear   VRT 15-NOV-2024
DEFINITION  PREDICTED: Ambystoma mexicanum vimentin (VIM), mRNA.
ACCESSION   XM_069648350
VERSION     XM_069648350.1
DBLINK      BioProject: PRJNA1165261
KEYWORDS    RefSeq.
SOURCE      Ambystoma mexicanum (axolotl)
  ORGANISM  Ambystoma mexicanum
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Caudata; Salamandroidea; Ambystomatidae;
            Ambystoma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090924) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_040938575.1-RS_2024_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/03/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1891
                     /organism="Ambystoma mexicanum"
                     /mol_type="mRNA"
                     /isolate="Mex_15411"
                     /db_xref="taxon:8296"
                     /chromosome="2q"
                     /sex="female"
                     /tissue_type="tail tip"
                     /geo_loc_name="USA: Kentucky, University of Kentucky"
                     /collection_date="2023-02"
     gene            1..1891
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 55 ESTs, 11 long SRA
                     reads, 11 Proteins"
                     /db_xref="GeneID:138569912"
     CDS             202..1608
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_069504451.1"
                     /db_xref="GeneID:138569912"
                     /translation="

MSTSTKSSSYRRMFGGSSGGGARPLSSSSSARYVTSSSRYNLGSSIRPSSSRMTFSSASSPAIYTKSSAGRLRSSMPPARLSDNVDFSLADAINLEFKANRTNEKAEMQELNDRFANFIDKVRFLEQQNKILLAELDQLKGKGTSRVGDLYEEELRELRRQVDQLTNEKARVEVDRDNMGDDIQRLREKFQDEMIQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQIQEHHVQIDMDVIKPDLTAALRDVRQQYESVASKNLAETEEWYKSKFADLSEAANRNNDALRQAKQDANDYRRQLQTLTCEVDALKGTNESLERQMRELEESFGMDAANYQDNINRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEECRITAPVHSFSAMNMRETNLESRPNDIQSKRTLLIKTVETRDGQVVNERDHDELELDME"

     polyA_site      1891
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

aggatgctgagggatgcccctgtccctgcccttccgctgattggccgagcggcgcggccaggcctctcattggtggagggccgcccgtccgggagggtcccgttatgtgggtattaaagagcgccccggacctcgcctgagccctgcaggagcgcgctagacacaagtacaggggagcagcaggaacagcacagcggcaccatgagcacctccaccaagagctcgtcctaccgcaggatgttcggcggcagcagcggcggcggggccaggccgctctcctcctcctcgtccgctcgctatgtcacctcgtccagccgctacaacctgggcagctccatccggccaagcagcagccggatgaccttctccagcgcctcctccccggccatctacaccaagtcctcggccggccggctgcgcagcagcatgcccccagcccggctctccgacaacgtggacttctccctggccgatgccatcaacctggagttcaaggccaaccgcaccaacgagaaggccgagatgcaggagctcaacgaccgcttcgccaacttcatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggaccagctcaagggcaagggcacgtcccgggtgggcgacctgtacgaggaggagctgcgggagctgcgccgccaggtggaccagctcaccaacgagaaggcacgcgtggaggtggaccgcgacaacatgggcgacgacatccagcgcctgcgcgaaaagtttcaggatgaaatgatccagcgagaggaagcggaaaacactctccagtctttcagacaggatgtcgacaacgcctcattggcacgccttgatctggagcgcaaagtcgagtccctgcaagaagaaatagtctttttgaagaaactacacgacgaagaaatccgcgaactgcaggcccagatccaggagcaccacgtccagattgacatggatgttattaaaccagacctaactgctgccctgcgcgatgtccgccaacagtacgaaagcgttgcaagcaaaaaccttgcagagaccgaagaatggtacaagtcaaagttcgctgatctttctgaagctgcgaatcgcaacaatgatgccctgcggcaagccaaacaggacgccaacgactaccgcaggcagctgcagaccctcacatgcgaagtggatgccctgaaaggaactaatgagtcgttggagcgccagatgcgcgagctggaagagagctttggcatggatgctgctaactaccaagacaacattaaccgccttcaggacgaaatccagaacatgaaggaagaaatggcgcgccacctgcgcgagtaccaggacctgctgaacgtaaagatggcccttgacattgagattgcaacctacaggaaactgttggagggcgaggagtgcaggatcactgcgccagtccactctttctctgctatgaacatgagagaaaccaaccttgaatcccgcccaaatgacatccaatcaaagaggacacttctgatcaagactgttgagaccagagatggacaggtcgtcaacgaaagggatcacgatgaattggaattggacatggagtgaagaggtagacccctgagagcccagcatgccttttcattgaaagagaaccttcaccagcaagatgaacccgcgctcagcttgcaagtgcctttttgcggttaattccagagcgcaagatagccacgatagtctgtaggtctggcaggcagaatcctctttctggaggatagaaaaaaagagtttacaacagagtctagtttacagaaaaacaaatagcaatatcttgtgctgcaatactgtttttttttaaatatcattccaataaaaagcttttttttccata

//