GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-03-14 18:00:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_066825029            3114 bp    mRNA    linear   PLN 31-JUL-2024
DEFINITION  Apiospora marii argonaute (PG985_005260), partial mRNA.
ACCESSION   XM_066825029
VERSION     XM_066825029.1
DBLINK      BioProject: PRJNA1140273
            BioSample: SAMN32718006
KEYWORDS    RefSeq.
SOURCE      Apiospora marii
  ORGANISM  Apiospora marii
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Xylariomycetidae; Xylariales; Apiosporaceae;
            Apiospora.
REFERENCE   1  (bases 1 to 3114)
  AUTHORS   Sorensen,T.
  TITLE     Analysis of 21 Apiospora genomes using comparative genomics revels
            a genus with tremendous synthesis potential of carbohydrate active
            enzymes and secondary metabolites
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 3114)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (26-JUL-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3114)
  AUTHORS   Sorensen,T.
  TITLE     Direct Submission
  JOURNAL   Submitted (13-JAN-2023) Department of Biosciences and Chemistry,
            Aalborg university, Fredrik Bajers Vej 7H, Aalborg, Nordjylland
            9220, Denmark
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_027117374).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3114
                     /organism="Apiospora marii"
                     /mol_type="mRNA"
                     /strain="CBS 49790"
                     /culture_collection="CBS:49790"
                     /db_xref="taxon:335849"
                     /chromosome="Unknown"
     gene            <1..>3114
                     /locus_tag="PG985_005260"
                     /db_xref="GeneID:92058090"
     CDS             1..3114
                     /locus_tag="PG985_005260"
                     /note="Argonaute linker 1 domain; Argonaute linker 2
                     domain; consensus disorder prediction; N-terminal domain
                     of argonaute; PAZ domain profile.; Piwi domain; Piwi
                     domain profile."
                     /codon_start=1
                     /product="argonaute"
                     /protein_id="XP_066688189.1"
                     /db_xref="GeneID:92058090"
                     /translation="
MSAGHKRGAGGGSASGSGPGQGSQRGSQSPAQHPPLTDRTADKGKQPAGGSDDQASSSKDKMPEAPKEITAQELKKLVDLPPGAFRTGDSDPEFTKRPGYNNDFVATVNLLVNMYQVTELPEAQDSVFQFSVLAAPNPKDSKTLAKRLWDSDTVQKWLKEHSKKLGRWIYDGRAMAWSLDPLPKEGVKIPVILPKKQQNSSTSKGGKGGKDPQAPDRFTLTIKPTTSFTLNQLDDYLTSKPGSKWDDVTTRQFNFLDHLLREGRSKDLTPIRRSFYSKRPQFSKKLGQHTQVITGTYAAFRPMHPMNPEHIRMCVNVDVAHTAFWNHRSTLHAAAMDMLLKSDFDGKCYGADWILEYLTDHDRVAQVNWQNVTQQLKPVRRGTDICMSEAFHMLRRLERTKFTIAHGKADKDKIYTVGSIFFDAKKYPNGADATNVSFTKKREDGSQFSSTVEAHFRSIGKTLQHPEFPLIKTPHGEVYFPFEVCYFAPMQRYTSKLLPDEKPIPWKTSAMIKAAISRPDKRHSDITRSVKELKLDKDDYLKAFGVTINTEGGMLRAHGRILSRPALEFRTKLDVPESHRWNLNNIKFHEGKPLKNWMAINCDNTKTPADCREFFTTFLNVYKSHAGVAIDTQAKHIENLKIISDLTEQRIKEMYKILEGKAKKYQPDAPVQMVFFLLPKRHIKVYNRIKKVMDCDLKIPSQVMTWEKIDLQNSPNALSQYCSNVSLKVNAKLGGVNCYARPAGGNKTSGYFSTKTMFIGLDVSHAPPGTNEASMAALAVSIDPRAIKYGAACQTNGVRTEMVRPDTMKSLLPRFIHRWRKEHNTHERLKGGGPDHLYFFRDGVDAGQFRDVLRTEVQAIKETFIEEIQESPKITVIIVTKRHHVRMFNADPNKGSAASRKHFDKNDNPKPGLLVEQGATHPEYWDFFLTSHNAIQGTSRPIHYQVILDEIECNPNDLQRMIFHHCYQYCRSTLPVSFHPAAFYAHIVSKRAVAHLQPPAPPTAAGQLPDPLPLLPMRDSTLLRHESSSIEQVMWFV"
     misc_feature    511..780
                     /locus_tag="PG985_005260"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    808..975
                     /locus_tag="PG985_005260"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    1108..1455
                     /locus_tag="PG985_005260"
                     /note="PAZ domain, named PAZ after the proteins Piwi
                     Argonaut and Zwille. PAZ is found in two families of
                     proteins that are essential components of RNA-mediated
                     gene-silencing pathways, including RNA interference, the
                     piwi and Dicer families. PAZ functions as a...; Region:
                     PAZ; cl00301"
                     /db_xref="CDD:469713"
     misc_feature    order(1243..1245,1354..1356,1366..1368,1432..1434,
                     1438..1440)
                     /locus_tag="PG985_005260"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239207"
     misc_feature    <1309..1503
                     /locus_tag="PG985_005260"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:460472"
     misc_feature    1618..2988
                     /locus_tag="PG985_005260"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
     misc_feature    order(2056..2058,2068..2070,2104..2115,2122..2124,
                     2161..2163,2170..2172,2182..2184,2194..2196)
                     /locus_tag="PG985_005260"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
     misc_feature    order(2284..2286,2290..2292,2524..2526,2956..2958)
                     /locus_tag="PG985_005260"
                     /note="active site"
                     /db_xref="CDD:239208"
ORIGIN      
atgtctgccggccataagcgcggcgcgggtgggggcagcgcgtcggggtccggacccggtcagggatctcaacgcgggtctcagtcgcctgcgcagcatcccccgttgactgacagaactgccgacaagggcaaacaaccggctggcggttcagatgatcaggctagtagttccaaggacaagatgcccgaggctccgaaagagataactgcgcaggaacttaagaaactagtagacttgccacctggcgcattccgcactggagattcggatcccgagttcacaaaacgaccgggctacaataacgatttcgtggcgactgtgaacttgcttgtcaacatgtaccaggtaacggagctacccgaagcccaggatagcgtcttccagttctccgtcttggccgccccaaacccaaaggactcgaagactttagccaaacgactttgggattctgacactgtccaaaagtggttgaaagaacacagcaagaagttgggacgttggatctacgatggccgagctatggcatggtcgcttgacccgttgcctaaggaaggggtgaaaatcccggtcattcttcctaagaagcagcagaactcttcgactagcaagggcggcaagggcggcaaagatccccaggcccctgaccgatttacattaactatcaagccgaccacctcgttcacactcaatcagctagacgactatctcactagcaagcccggctctaagtgggacgacgtcacgacgaggcagttcaacttcctcgatcatctgctgcgggaaggacgatcaaaggatcttactcctatccgacgaagcttctacagcaaacgaccccagtttagcaagaagctgggtcaacacacgcaagtcataacgggcacgtatgccgcgttcagaccgatgcatccaatgaaccccgaacacatccggatgtgtgtcaatgtagatgttgctcacacggcattctggaatcacaggtccactctgcatgcggcagctatggatatgcttctgaagagcgatttcgatggtaagtgctatggtgccgactggatactcgaataccttactgaccatgaccgcgtcgcccaagttaattggcagaatgtcacacaacaactgaagcccgtccgacgaggtaccgatatctgcatgtctgaagccttccacatgttgcggcgactcgaaaggaccaagttcaccattgcccacggcaaggccgacaaggacaagatctacacggtgggtagcatcttctttgacgccaagaagtatcccaacggcgcggatgcgaccaatgtttcatttacgaagaagagagaggatggatcgcaattcagctccacggtcgaggcgcatttccgatcgatcgggaagacactccagcatcccgagtttccgctcatcaaaacacctcatggggaggtttacttcccgtttgaagtatgttacttcgccccgatgcagcggtatacttccaagcttctcccagatgagaaacctattccctggaagacctcagcgatgatcaaggcggccatctcccgcccggataagagacacagtgatattaccagaagtgtcaaagagcttaaattggataaagacgactacctcaaggcattcggcgtcaccatcaacaccgaggggggcatgcttcgcgcccatggccgtatccttagtcggccggccctcgagtttcgtacaaaacttgacgtcccagagagccatcgatggaatttgaacaatatcaagtttcatgaggggaagccactcaagaattggatggctatcaattgcgataacaccaaaacaccagctgattgccgagagttcttcaccacctttttgaacgtgtacaagtcgcatgctggtgtcgcgattgatacgcaagcgaaacatattgagaatctcaagattatttccgatctgacagagcagcgcatcaaggagatgtacaagatactagaaggcaaggcaaagaaataccagccggatgcacctgtacaaatggttttcttcctcttgccaaagagacacatcaaggtctacaaccggatcaaaaaggttatggactgcgatttgaagattccttctcaggtcatgacttgggaaaagattgatcttcagaatagtcccaacgcgcttagtcaatactgcagcaatgtgtcgctgaaggtcaatgcgaagctggggggtgtcaattgttacgcaagacccgcagggggtaacaaaacgtccggctacttctcgacgaagaccatgttcattggtctcgacgtgtctcacgcgccccccggaaccaacgaggcttctatggctgcgttggccgtatcgattgatccacgcgccatcaaatacggcgctgcttgtcagaccaacggagtccgtaccgagatggtgcgtccggatacgatgaagtctctgctgcctcgcttcatacatcggtggcgcaaagagcacaacacacacgaaaggctcaagggaggcgggcccgatcacctctacttcttccgagacggcgtggatgcaggccagttccgcgacgtccttcgcaccgaggtacaagccatcaaggaaacctttatagaggagatccaggagtcacccaagataacggtcatcatcgtcactaagcgacatcacgtacggatgttcaacgcggacccgaacaaggggtcggctgcgagccgcaaacactttgacaaaaacgacaaccccaagccgggcctgctagtggagcaaggggccacgcatccggagtattgggacttcttcctcacttcccacaacgccattcagggcacctcgcgccccatccactaccaggtcatcctagacgagatcgaatgcaatccaaatgatcttcaacgcatgatctttcatcattgctaccagtattgtcgctccaccctgcccgtctcatttcaccccgccgccttttacgctcacatagtttcgaagcgtgctgtggcccatttgcagcctccggctccgccgacggcagcgggacagctaccagacccgttgcctcttctccccatgagagattctacgctcctgcggcatgagtccagtagcatcgagcaggtcatgtggtttgtctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]